Clone: HsCD00399354

Clone ID:HsCD00399354
Is Verified:Y
Status:AVAILABLE
Source:The ORFeome Collaboration
Description:Synthetic construct Homo sapiens clone IMAGE:100069226, MGC:199237 choroideremia (Rab escort protein 1) (CHM) mRNA.
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

GenBank Accession BC172532
Gene ID 1121
Gene Symbol CHM
GI 225000263
IMAGE ID 100069226
MGC ID 199237
Original Clone ID 100069226

Property:

Collection: MGC
Collection: OCAB
Collection: The ORFeome Collaboration

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 1962 Homo sapiens CLOSED DNA template 1121 CHM Homo sapiens choroideremia (Rab escort protein 1) (CHM), transcript variant 1, mRNA.
Insert1
Size (bp)1962
SpeciesHomo sapiens
FormatCLOSED
Tissue SourceDNA template
Species Specific ID 1121
Gene SymbolCHM
Gene NameHomo sapiens choroideremia (Rab escort protein 1) (CHM), transcript variant 1, mRNA.
Keyword

Insert Sequence:

ATGGCGGATACTCTCCCTTCGGAGTTTGATGTGATCGTAATAGGGACGGGTTTGCCTGAATCCATCATTGCAGCTGCATGTTCAAGAAGTGGCCGGAGAGTTCTGCATGTTGATTCAAGAAGCTACTATGGAGGAAACTGGGCCAGTTTTAGCTTTTCAGGACTATTGTCCTGGCTAAAGGAATACCAGGAAAACAGTGACATTGTAAGTGACAGTCCAGTGTGGCAAGACCAGATCCTTGAAAATGAAGAAGCCATTGCTCTTAGCAGGAAGGACAAAACTATTCAACATGTGGAAGTATTTTGTTATGCCAGTCAGGATTTGCATGAAGATGTCGAAGAAGCTGGTGCACTGCAGAAAAATCATGCTCTTGTGACATCTGCAAACTCCACAGAAGCTGCAGATTCTGCCTTCCTGCCTACGGAGGATGAGTCATTAAGCACTATGAGCTGTGAAATGCTCACAGAACAAACTCCAAGCAGCGATCCAGAGAATGCGCTAGAAGTAAATGGTGCTGAAGTGACAGGGGAAAAAGAAAACCATTGTGATGATAAAACTTGTGTGCCATCAACTTCAGCAGAAGACATGAGTGAAAATGTGCCTATAGCAGAAGATACCACAGAGCAACCAAAGAAAAACAGAATTACTTACTCACAAATTATTAAAGAAGGCAGGAGATTTAATATTGATTTAGTATCAAAGCTGCTGTATTCTCGAGGATTACTAATTGATCTTCTAATCAAATCTAATGTTAGTCGATATGCAGAGTTTAAAAATATTACCAGGATTCTTGCATTTCGAGAAGGACGAGTGGAACAGGTTCCGTGTTCCAGAGCAGATGTCTTTAATAGCAAACAACTTACTATGGTAGAAAAGCGAATGCTAATGAAATTTCTTACATTTTGTATGGAATATGAGAAATATCCTGATGAATATAAAGGATATGAAGAGATCACATTTTATGAATATTTAAAGACTCAAAAATTAACCCCCAACCTCCAATATATTGTCATGCATTCAATTGCAATGACATCAGAGACAGCCAGCAGCACCATAGATGGTCTCAAAGCTACCAAAAACTTTCTTCACTGTCTTGGGCGGTATGGCAACACTCCATTTTTGTTTCCTTTATATGGCCAAGGAGAACTCCCCCAGTGTTTCTGCAGGATGTGTGCTGTGTTTGGTGGAATTTATTGTCTTCGCCATTCAGTACAGTGCCTTGTAGTGGACAAAGAATCCAGAAAATGTAAAGCAATTATAGATCAGTTTGGTCAGAGAATAATCTCTGAGCATTTCCTCGTGGAGGACAGTTACTTTCCTGAGAACATGTGCTCACGTGTGCAATACAGGCAGATCTCCAGGGCAGTGCTGATTACAGATAGATCTGTCCTAAAAACAGATTCAGATCAACAGATTTCCATTTTGACAGTGCCAGCAGAGGAACCAGGAACTTTTGCTGTTCGGGTCATTGAGTTATGTTCTTCAACGATGACATGCATGAAAGGCACCTATTTGGTTCATTTGACTTGCACATCTTCTAAAACAGCAAGAGAAGATTTAGAATCAGTTGTGCAGAAATTGTTTGTTCCATATACTGAAATGGAGATAGAAAATGAACAAGTAGAAAAGCCAAGAATTCTGTGGGCTCTTTACTTCAATATGAGAGATTCGTCAGACATCAGCAGGAGCTGTTATAATGATTTACCATCCAACGTTTATGTCTGCTCTGGCCCAGATTGTGGTTTAGGAAATGATAATGCAGTCAAACAGGCTGAAACACTTTTCCAGGAAATCTGCCCCAATGAAGATTTCTGTCCCCCTCCACCAAATCCTGAAGACATTATCCTTGATGGAGACAGTTTACAGCCAGAGGCTTCAGAATCCAGTGCCATACCAGAGGCTAACTCGGAGACTTTCAAGGAAAGCACAAACCTTGGAAACCTAGAGGAGTCCTCTGAATAA

Insert Property: Insert 1

Type Value Extra Information
3 Prime Linker Sequence TAAGGCCTCATGGgcccagctttcttg
5 Prime Linker Sequence gtacaaaaaagcagaagGGCCGTCAAGGCCCACC
CDS Start 1
CDS Stop 1962

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGGCGGATACTCTCCCTTCGGAGTTTGATGTGATCGTAATAGGGACGGGTTTGCCTGAATCCATCATTGCAGCTGCATGTTCAAGAAGTGGCCGGAGAGTTCTGCATGTTGATTCAAGAAGCTACTATGGAGGAAACTGGGCCAGTTTTAGCTTTTCAGGACTATTGTCCTGGCTAAAGGAATACCAGGAAAACAGTGACATTGTAAGTGACAGTCCAGTGTGGCAAGACCAGATCCTTGAAAATGAAGAAGCCATTGCTCTTAGCAGGAAGGACAAAACTATTCAACATGTGGAAGTATTTTGTTATGCCAGTCAGGATTTGCATGAAGATGTCGAAGAAGCTGGTGCACTGCAGAAAAATCATGCTCTTGTGACATCTGCAAACTCCACAGAAGCTGCAGATTCTGCCTTCCTGCCTACGGAGGATGAGTCATTAAGCACTATGAGCTGTGAAATGCTCACAGAACAAACTCCAAGCAGCGATCCAGAGAATGCGCTAGAAGTAAATGGTGCTGAAGTGACAGGGGAAAAAGAAAACCATTGTGATGATAAAACTTGTGTGCCATCAACTTCAGCAGAAGACATGAGTGAAAATGTGCCTATAGCAGAAGATACCACAGAGCAACCAAAGAAAAACAGAATTACTTACTCACAAATTATTAAAGAAGGCAGGAGATTTAATATTGATTTAGTATCAAAGCTGCTGTATTCTCGAGGATTACTAATTGATCTTCTAATCAAATCTAATGTTAGTCGATATGCAGAGTTTAAAAATATTACCAGGATTCTTGCATTTCGAGAAGGACGAGTGGAACAGGTTCCGTGTTCCAGAGCAGATGTCTTTAATAGCAAACAACTTACTATGGTAGAAAAGCGAATGCTAATGAAATTTCTTACATTTTGTATGGAATATGAGAAATATCCTGATGAATATAAAGGATATGAAGAGATCACATTTTATGAATATTTAAAGACTCAAAAATTAACCCCCAACCTCCAATATATTGTCATGCATTCAATTGCAATGACATCAGAGACAGCCAGCAGCACCATAGATGGTCTCAAAGCTACCAAAAACTTTCTTCACTGTCTTGGGCGGTATGGCAACACTCCATTTTTGTTTCCTTTATATGGCCAAGGAGAACTCCCCCAGTGTTTCTGCAGGATGTGTGCTGTGTTTGGTGGAATTTATTGTCTTCGCCATTCAGTACAGTGCCTTGTAGTGGACAAAGAATCCAGAAAATGTAAAGCAATTATAGATCAGTTTGGTCAGAGAATAATCTCTGAGCATTTCCTCGTGGAGGACAGTTACTTTCCTGAGAACATGTGCTCACGTGTGCAATACAGGCAGATCTCCAGGGCAGTGCTGATTACAGATAGATCTGTCCTAAAAACAGATTCAGATCAACAGATTTCCATTTTGACAGTGCCAGCAGAGGAACCAGGAACTTTTGCTGTTCGGGTCATTGAGTTATGTTCTTCAACGATGACATGCATGAAAGGCACCTATTTGGTTCATTTGACTTGCACATCTTCTAAAACAGCAAGAGAAGATTTAGAATCAGTTGTGCAGAAATTGTTTGTTCCATATACTGAAATGGAGATAGAAAATGAACAAGTAGAAAAGCCAAGAATTCTGTGGGCTCTTTACTTCAATATGAGAGATTCGTCAGACATCAGCAGGAGCTGTTATAATGATTTACCATCCAACGTTTATGTCTGCTCTGGCCCAGATTGTGGTTTAGGAAATGATAATGCAGTCAAACAGGCTGAAACACTTTTCCAGGAAATCTGCCCCAATGAAGATTTCTGTCCCCCTCCACCAAATCCTGAAGACATTATCCTTGATGGAGACAGTTTACAGCCAGAGGCTTCAGAATCCAGTGCCATACCAGAGGCTAACTCGGAGACTTTCAAGGAAAGCACAAACCTTGGAAACCTAGAGGAGTCCTCTGAATAAGGCCTCATGGGCCCAGCTTTCTTGTACAAAGTTGGCATTATAAAAAATAATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGCCTCCTCTAGACCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTACCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAACCCTCGAGCCACCCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT

Sequencing Information:

Phred Score: 701
Date: 2019-02-15

Last Passing Sequencing Read:

NNNAACCGCATAGATTTATTTTGACTGATAGTGACTGTTCGTTGCTCAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGGCGGATACTCTCCCTTCGGAGTTTGATGTGATCGTAATAGGGACGGGTTTGCCTGAATCCATCATTGCAGCTGCATGTTCAAGAAGTGGCCGGAGAGTTCTGCATGTTGATTCAAGAAGCTACTATGGAGGAAACTGGGCCAGTTTTAGCTTTTCAGGACTATTGTCCTGGCTAAAGGAATACCAGGAAAACAGTGACATTGTAAGTGACAGTCCAGTGTGGCAAGACCAGATCCTTGAAAATGAAGAAGCCATTGCTCTTAGCAGGAAGGACAAAACTATTCAACATGTGGAAGTATTTTGTTATGCCAGTCAGGATTTGCATGAAGATGTCGAATAAGCTGGTGCACTGCACAAAAATCATGCTCTTGTGACATCTGCAAACTCCACAGAAGCTGCAGATTCTGCCTTCCTGCCTACGGAGGATGAGTCATTAAGCACTATGAGCTGTGAAATGCTCACAGAACAAACTCCAAGCAGCGATCCAGAGAATGCGCTAGAAGTAAATGGTGCTGAAGTGACAGGGGAAAAAGAAAACCATTGTGATGATAAAACTTGTGTGCCATCAACTTCAGCAGAAGACATGAGTGAAAATGTGCCTATAGCAGAAGATACCACAGAGCAACCAAAGAATAACAGAATTACTTACTCACAAATTATTACAGAAAGCAGGAGATTTAATATTGATTTACTATCAAAGCTGCTGTATTCTCGAGGATTACTAATTGATCTTCTGATCAAATCTAATGTTAGACGATATGCAGAGTTTANTACTATTACCAGGATTCTTGCATTTCGAGAAGGACGACTGGAACATGTTCCGTGTTCCAAAGCAAATGTCTTTTATAGCAANCAACTTACTATGGTAGAAAATCGAATGCTAATGAAATTTCTTAATTTTGTATGCAATATGAAAATATTCTGATGCATATGAGGGATATGAGACATCCCGTTTTATGATTATTCAAGACTCAAAAATAACCCCCACCTCCCATTATTGCCAGGCATCATTTGCATACCTCCAAAACGCTCGCACACTTTAATGGCCTAAACTTCCAAAAATTTTTCCTGTTTGGGGGGCTTGGAACCCCCATTTTGATTCCTTAAGGGCAAGAAAAACCCCCCGGTTTTCCCCCAGGGGACTGTTTTGGGAATTTTGGTTCTCCTTTCAGCGAGGCTT

Vector Information:

Vector Name:pENTR223
Type:bacterial plasmid
Description:Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Properties:recombinational cloning
Comments:Additional information about this vector is available from the commercial website and at the ORFeome website http://www.orfeomecollaboration.org/html/vectors.shtml; also see supplemental figure 1 of the paper PubMed ID 15489335.
Map:pDONR223.1.gif
Sequence:pENTR223-seq.doc
Size (bp):2815
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
Mach1 T1-R Y E. coli Mach1 bacterial host strain with T1 phage resistance

Antibiotic Selections:

Host Type Marker
bacterial spectinomycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL spectinomycin Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.

Authors:

Author Name Author Type
The ORFeome Collaboration Consortium
MGC Consortium

Publications:

PMID Title
12477932 Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences.