Clone: HsCD00399135

Clone ID:HsCD00399135
Is Verified:Y
Status:AVAILABLE
Source:The ORFeome Collaboration
Description:Synthetic construct Homo sapiens clone IMAGE:100069005, MGC:199016 mortality factor 4 (MORF4) mRNA.
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

GenBank Accession BC172311
Gene ID 10934
Gene Symbol MORF4
GI 225000079
IMAGE ID 100069005
MGC ID 199016
Original Clone ID 100069005

Property:

Collection: MGC
Collection: OCAB
Collection: The ORFeome Collaboration

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 708 Homo sapiens CLOSED DNA template 10934 MORF4 Homo sapiens mortality factor 4 (MORF4), mRNA.
Insert1
Size (bp)708
SpeciesHomo sapiens
FormatCLOSED
Tissue SourceDNA template
Species Specific ID 10934
Gene SymbolMORF4
Gene NameHomo sapiens mortality factor 4 (MORF4), mRNA.
Keyword

Insert Sequence:

ATGAGATGGGCTGCCCCAGGAAAGAAGACATCTGGTCTGCAACAGAAAAATATTGAAGTGAAAACAAAAAAGAACAAACAGAAAACACCTGGAAATGGAGATGGTGGCAGTACCAGTGAGACTCCCCAGCCTCCTCGAAAGAAAAGGGCCCAGGTAGATCCTACTGTTGAAAATGAGGAAACATTCATGAACAGAGTTGAAGTTAAAGTAAAGATTCCTGAAGAGCTAAAACCATGGCTTGTTGATGACTGGGACTTAATTACCAGGCAAAAACAGCTCTTCTATCTTCCTGCCGAGAAGAATGTGGATTCCATTCTTGAGGACTATGCAAATTACAAGAAATCTCATGGAAACACAGATAATAAGGAGTATGCAGTTAATGAAGTTGTGGCAGGGATAAAAGAATACTTCAACCTAATGTTGGGCACCCAGCTACTCAACAAATTTGAGAGACCACAGTATGCCGAAATTCTTGCAGATTGTCCCGATGCACCCATGTCCCAGGTGTATGGAGTGCCACATCTCCTGAGATTATCTGTACAAATTGGAGCAATGTTGGCCTATACACCTCTGAATGAGAAGAGCCTTGCTTTATTACTCAATTATCTTCACGATTTCCTAAAGTACCTGGCAAAGAATTCTGCAACTTTGTTTAGTGCCAGCGATTATGAAGTGGCTCTTCCTGAGTACCATCGGAAAGCTGTGTAG

Insert Property: Insert 1

Type Value Extra Information
3 Prime Linker Sequence TAAGGCCTCATGGgcccagctttcttg
5 Prime Linker Sequence gtacaaaaaagcagaagGGCCGTCAAGGCCCACC
CDS Start 1
CDS Stop 708

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGAGATGGGCTGCCCCAGGAAAGAAGACATCTGGTCTGCAACAGAAAAATATTGAAGTGAAAACAAAAAAGAACAAACAGAAAACACCTGGAAATGGAGATGGTGGCAGTACCAGTGAGACTCCCCAGCCTCCTCGAAAGAAAAGGGCCCAGGTAGATCCTACTGTTGAAAATGAGGAAACATTCATGAACAGAGTTGAAGTTAAAGTAAAGATTCCTGAAGAGCTAAAACCATGGCTTGTTGATGACTGGGACTTAATTACCAGGCAAAAACAGCTCTTCTATCTTCCTGCCGAGAAGAATGTGGATTCCATTCTTGAGGACTATGCAAATTACAAGAAATCTCATGGAAACACAGATAATAAGGAGTATGCAGTTAATGAAGTTGTGGCAGGGATAAAAGAATACTTCAACCTAATGTTGGGCACCCAGCTACTCAACAAATTTGAGAGACCACAGTATGCCGAAATTCTTGCAGATTGTCCCGATGCACCCATGTCCCAGGTGTATGGAGTGCCACATCTCCTGAGATTATCTGTACAAATTGGAGCAATGTTGGCCTATACACCTCTGAATGAGAAGAGCCTTGCTTTATTACTCAATTATCTTCACGATTTCCTAAAGTACCTGGCAAAGAATTCTGCAACTTTGTTTAGTGCCAGCGATTATGAAGTGGCTCTTCCTGAGTACCATCGGAAAGCTGTGTAGGGCCTCATGGGCCCAGCTTTCTTGTACAAAGTTGGCATTATAAAAAATAATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGCCTCCTCTAGACCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTACCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAACCCTCGAGCCACCCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT

Vector Information:

Vector Name:pENTR223
Type:bacterial plasmid
Description:Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Properties:recombinational cloning
Comments:Additional information about this vector is available from the commercial website and at the ORFeome website http://www.orfeomecollaboration.org/html/vectors.shtml; also see supplemental figure 1 of the paper PubMed ID 15489335.
Map:pDONR223.1.gif
Sequence:pENTR223-seq.doc
Size (bp):2815
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
Mach1 T1-R Y E. coli Mach1 bacterial host strain with T1 phage resistance

Antibiotic Selections:

Host Type Marker
bacterial spectinomycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL spectinomycin Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.

Authors:

Author Name Author Type
The ORFeome Collaboration Consortium
MGC Consortium

Publications:

PMID Title
12477932 Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences.