Clone: HsCD00383950

Clone ID:HsCD00383950
Is Verified:Y
Status:AVAILABLE
Source:The ORFeome Collaboration
Description:Synthetic construct Homo sapiens clone IMAGE:100071820; CCSB013689_02 TIMP metallopeptidase inhibitor 2 (TIMP2) gene.
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

Gene Symbol TIMP2
Gene ID 7077
Open Biosystems Catalog Number OHS5894-101524196
Open Biosystems Clone ID 101524196
Original Clone ID 100071820
IMAGE ID 100071820
GenBank Accession HQ448393
GI 312152721

Property:

Collection: Center for Cancer Systems Biology
Collection: OCAB
Collection: The ORFeome Collaboration

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 660 Homo sapiens FUSION DNA template 7077 TIMP2 Homo sapiens TIMP metallopeptidase inhibitor 2, mRNA (cDNA clone MGC:59751 IMAGE:6267022), complete cds.
Insert1
Size (bp)660
SpeciesHomo sapiens
FormatFUSION
Tissue SourceDNA template
Species Specific ID 7077
Gene SymbolTIMP2
Gene NameHomo sapiens TIMP metallopeptidase inhibitor 2, mRNA (cDNA clone MGC:59751 IMAGE:6267022), complete cds.
Keyword

Insert Sequence:

ATGGGCGCCGCGGCCCGCACCCTGCGGCTGGCGCTCGGCCTCCTGCTGCTGGCGACGCTGCTTCGCCCGGCCGACGCCTGCAGCTGCTCCCCGGTGCACCCGCAACAGGCGTTTTGCAATGCAGATGTAGTGATCAGGGCCAAAGCGGTCAGTGAGAAGGAAGTGGACTCTGGAAACGACATTTATGGCAACCCTATCAAGAGGATCCAGTATGAGATCAAGCAGATAAAGATGTTCAAAGGGCCTGAGAAGGATATAGAGTTTATCTACACGGCCCCCTCCTCGGCAGTGTGTGGGGTCTCGCTGGACGTTGGAGGAAAGAAGGAATATCTCATTGCAGGAAAGGCCGAGGGGGACGGCAAGATGCACATCACCCTCTGTGACTTCATCGTGCCCTGGGACACCCTGAGCACCACCCAGAAGAAGAGCCTGAACCACAGGTACCAGATGGGCTGCGAGTGCAAGATCACGCGCTGCCCCATGATCCCGTGCTACATCTCCTCCCCGGACGAGTGCCTCTGGATGGACTGGGTCACAGAGAAGAACATCAACGGGCACCAGGCCAAGTTCTTCGCCTGCATCAAGAGAAGTGACGGCTCCTGTGCGTGGTACCGCGGCGCGGCGCCCCCCAAGCAGGAGTTTCTCGACATCGAGGACCCA

Insert Property: Insert 1

Type Value Extra Information
3 Prime Linker Sequence tacccaactttcttgtac
5 Prime Linker Sequence gtacaaaaaagttggc
CDS Start 1
CDS Stop 660

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGATGGGCGCCGCGGCCCGCACCCTGCGGCTGGCGCTCGGCCTCCTGCTGCTGGCGACGCTGCTTCGCCCGGCCGACGCCTGCAGCTGCTCCCCGGTGCACCCGCAACAGGCGTTTTGCAATGCAGATGTAGTGATCAGGGCCAAAGCGGTCAGTGAGAAGGAAGTGGACTCTGGAAACGACATTTATGGCAACCCTATCAAGAGGATCCAGTATGAGATCAAGCAGATAAAGATGTTCAAAGGGCCTGAGAAGGATATAGAGTTTATCTACACGGCCCCCTCCTCGGCAGTGTGTGGGGTCTCGCTGGACGTTGGAGGAAAGAAGGAATATCTCATTGCAGGAAAGGCCGAGGGGGACGGCAAGATGCACATCACCCTCTGTGACTTCATCGTGCCCTGGGACACCCTGAGCACCACCCAGAAGAAGAGCCTGAACCACAGGTACCAGATGGGCTGCGAGTGCAAGATCACGCGCTGCCCCATGATCCCGTGCTACATCTCCTCCCCGGACGAGTGCCTCTGGATGGACTGGGTCACAGAGAAGAACATCAACGGGCACCAGGCCAAGTTCTTCGCCTGCATCAAGAGAAGTGACGGCTCCTGTGCGTGGTACCGCGGCGCGGCGCCCCCCAAGCAGGAGTTTCTCGACATCGAGGACCCAATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGCCTCCTCTAGACCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTACCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAACCCTCGAGCCACCCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT

Vector Information:

Vector Name:pENTR223
Type:bacterial plasmid
Description:Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Properties:recombinational cloning
Comments:Additional information about this vector is available from the commercial website and at the ORFeome website http://www.orfeomecollaboration.org/html/vectors.shtml; also see supplemental figure 1 of the paper PubMed ID 15489335.
Map:pDONR223.1.gif
Sequence:pENTR223-seq.doc
Size (bp):2815
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH10B TonA Y

Antibiotic Selections:

Host Type Marker
bacterial spectinomycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL spectinomycin Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.

Authors:

Author Name Author Type
The ORFeome Collaboration Consortium
Center for Cancer Systems Biology Clone creator

Publications:

PMID Title
17207965 hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes.