Clone: HsCD00383454

Clone ID:HsCD00383454
Is Verified:Y
Status:AVAILABLE
Source:The ORFeome Collaboration
Description:Synthetic construct Homo sapiens clone IMAGE:100071293; CCSB003260_01 family with sequence similarity 46, member A (FAM46A) gene.
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

Open Biosystems Clone ID 101523651
Original Clone ID 100071293
GI 312151807
IMAGE ID 100071293
Gene Symbol FAM46A
Open Biosystems Catalog Number OHS5894-101523651
Gene ID 55603
GenBank Accession HQ447932

Property:

Collection: Center for Cancer Systems Biology
Collection: OCAB
Collection: The ORFeome Collaboration

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 1326 Homo sapiens FUSION DNA template 55603 FAM46A Homo sapiens family with sequence similarity 46, member A, mRNA (cDNA clone MGC:1079 IMAGE:3349780), complete cds.
Insert1
Size (bp)1326
SpeciesHomo sapiens
FormatFUSION
Tissue SourceDNA template
Species Specific ID 55603
Gene SymbolFAM46A
Gene NameHomo sapiens family with sequence similarity 46, member A, mRNA (cDNA clone MGC:1079 IMAGE:3349780), complete cds.
Keyword

Insert Sequence:

ATGGCGGAGGGTGAAGGGTACTTCGCCATGTCTGAGGACGAGCTGGCCTGCAGCCCCTACATCCCCCTAGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGTGGCGGCAGCTTCGGTGGGCATTGCTTGGACTATTGCGAAAGCCCTACGGCGCACTGCAATGTGCTGAACTGGGAGCAAGTGCAGCGGCTGGACGGCATCCTGAGCGAGACCATTCCGATTCACGGGCGCGGCAACTTCCCCACGCTCGAGCTGCAGCCGAGCCTGATCGTGAAGGTGGTGCGGCGGCGCCTGGCCGAGAAGCGCATTGGCGTCCGCGACGTGCGCCTCAACGGCTCGGCAGCCAGCCATGTCCTGCACCAGGACAGCGGCCTGGGCTACAAGGACCTGGACCTCATCTTCTGCGCCGACCTGCGCGGGGAAGGGGAGTTTCAGACTGTGAAGGACGTCGTGCTGGACTGCCTGTTGGACTTCTTACCCGAGGGGGTGAACAAAGAGAAGATCACACCACTCACGCTCAAGGAAGCTTATGTGCAGAAAATGGTTAAAGTGTGCAATGACTCTGACCGATGGAGTCTTATATCCCTGTCAAACAACAGTGGCAAAAATGTGGAACTGAAATTTGTGGATTCCCTCCGGAGGCAGTTTGAATTCAGTGTAGATTCTTTTCAAATCAAATTAGACTCTCTTCTGCTCTTTTATGAATGTTCAGAGAACCCAATGACTGAGACATTTCACCCCACAATAATCGGGGAGAGCGTCTATGGCGATTTCCAGGAAGCCTTTGATCACCTTTGTAACAAGATCATTGCCACCAGGAACCCAGAGGAAATCCGAGGGGGAGGCCTGCTTAAGTACTGCAACCTCTTGGTGAGGGGCTTTAGGCCCGCCTCTGATGAAATCAAGACCCTTCAAAGGTATATGTGTTCCAGGTTTTTCATCGACTTCTCAGACATTGGAGAGCAGCAGAGAAAACTGGAGTCCTATTTGCAGAACCACTTTGTGGGATTGGAAGACCGCAAGTATGAGTATCTCATGACCCTTCATGGAGTGGTAAATGAGAGCACAGTGTGCCTGATGGGACATGAAAGAAGACAGACTTTAAACCTTATCACCATGCTGGCTATCCGGGTGTTAGCTGACCAAAATGTCATTCCTAATGTGGCTAATGTCACTTGCTATTACCAGCCAGCCCCCTATGTAGCAGATGCCAACTTTAGCAATTACTACATTGCACAGGTTCAGCCAGTATTCACGTGCCAGCAACAGACCTACTCCACTTGGCTACCCTGCAAT

Insert Property: Insert 1

Type Value Extra Information
3 Prime Linker Sequence tacccaactttcttgtac
5 Prime Linker Sequence gtacaaaaaagttggc
CDS Stop 1326
CDS Start 1

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGATGGCGGAGGGTGAAGGGTACTTCGCCATGTCTGAGGACGAGCTGGCCTGCAGCCCCTACATCCCCCTAGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGTGGCGGCAGCTTCGGTGGGCATTGCTTGGACTATTGCGAAAGCCCTACGGCGCACTGCAATGTGCTGAACTGGGAGCAAGTGCAGCGGCTGGACGGCATCCTGAGCGAGACCATTCCGATTCACGGGCGCGGCAACTTCCCCACGCTCGAGCTGCAGCCGAGCCTGATCGTGAAGGTGGTGCGGCGGCGCCTGGCCGAGAAGCGCATTGGCGTCCGCGACGTGCGCCTCAACGGCTCGGCAGCCAGCCATGTCCTGCACCAGGACAGCGGCCTGGGCTACAAGGACCTGGACCTCATCTTCTGCGCCGACCTGCGCGGGGAAGGGGAGTTTCAGACTGTGAAGGACGTCGTGCTGGACTGCCTGTTGGACTTCTTACCCGAGGGGGTGAACAAAGAGAAGATCACACCACTCACGCTCAAGGAAGCTTATGTGCAGAAAATGGTTAAAGTGTGCAATGACTCTGACCGATGGAGTCTTATATCCCTGTCAAACAACAGTGGCAAAAATGTGGAACTGAAATTTGTGGATTCCCTCCGGAGGCAGTTTGAATTCAGTGTAGATTCTTTTCAAATCAAATTAGACTCTCTTCTGCTCTTTTATGAATGTTCAGAGAACCCAATGACTGAGACATTTCACCCCACAATAATCGGGGAGAGCGTCTATGGCGATTTCCAGGAAGCCTTTGATCACCTTTGTAACAAGATCATTGCCACCAGGAACCCAGAGGAAATCCGAGGGGGAGGCCTGCTTAAGTACTGCAACCTCTTGGTGAGGGGCTTTAGGCCCGCCTCTGATGAAATCAAGACCCTTCAAAGGTATATGTGTTCCAGGTTTTTCATCGACTTCTCAGACATTGGAGAGCAGCAGAGAAAACTGGAGTCCTATTTGCAGAACCACTTTGTGGGATTGGAAGACCGCAAGTATGAGTATCTCATGACCCTTCATGGAGTGGTAAATGAGAGCACAGTGTGCCTGATGGGACATGAAAGAAGACAGACTTTAAACCTTATCACCATGCTGGCTATCCGGGTGTTAGCTGACCAAAATGTCATTCCTAATGTGGCTAATGTCACTTGCTATTACCAGCCAGCCCCCTATGTAGCAGATGCCAACTTTAGCAATTACTACATTGCACAGGTTCAGCCAGTATTCACGTGCCAGCAACAGACCTACTCCACTTGGCTACCCTGCAATATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGCCTCCTCTAGACCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTACCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAACCCTCGAGCCACCCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT

Vector Information:

Vector Name:pENTR223
Type:bacterial plasmid
Description:Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Properties:recombinational cloning
Comments:Additional information about this vector is available from the commercial website and at the ORFeome website http://www.orfeomecollaboration.org/html/vectors.shtml; also see supplemental figure 1 of the paper PubMed ID 15489335.
Map:pDONR223.1.gif
Sequence:pENTR223-seq.doc
Size (bp):2815
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH10B TonA Y

Antibiotic Selections:

Host Type Marker
bacterial spectinomycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL spectinomycin Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.

Authors:

Author Name Author Type
The ORFeome Collaboration Consortium
Center for Cancer Systems Biology Clone creator

Publications:

PMID Title
17207965 hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes.