Clone: HsCD00366705

Clone ID:HsCD00366705
Is Verified:Y
Status:AVAILABLE
Source:The ORFeome Collaboration
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

Broad Clone ID ccsbBroadEn_04377
Original Clone ID 5735

Property:

Collection: CCSB 31b
Collection: Center for Cancer Systems Biology
Collection: The ORFeome Collaboration

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 630 Homo sapiens FUSION DNA template from Open Biosystems 84324 CIP29 Homo sapiens cytokine induced protein 29 kDa, mRNA (cDNA clone MGC:14726 IMAGE:4273903), complete cds.
Insert1
Size (bp)630
SpeciesHomo sapiens
FormatFUSION
Tissue SourceDNA template from Open Biosystems
Species Specific ID 84324
Gene SymbolCIP29
Gene NameHomo sapiens cytokine induced protein 29 kDa, mRNA (cDNA clone MGC:14726 IMAGE:4273903), complete cds.
Keyword

Insert Sequence:

ATGGCGACCGAGACGGTGGAGCTCCATAAGCTAAAGCTTGCCGAACTAAAGCAAGAATGTCTTGCTCGTGGTTTGGAGACCAAGGGAATAAAGCAAGATCTTATCCACAGACTCCAGGCATATCTTGAAGAACATGCTGAAGAGGAGGCAAATGAAGAAGATGTACTGGGAGATGAAACAGAGGAAGAAGAAACAAAGCCCATTGAGCTCCCTGTCAAAGAGGAAGAACCCCCTGAAAAAACTGTTGATGTGGCAGCAGAGAAGAAAGTGGTGAAAATTACATCTGAAATACCACAGACTGAGAGAATGCAGAAGAGGGCTGAACGATTCAATGTACCTGTGAGCTTGGAGAGTAAGAAAGCTGCTCGGGCAGCTAGGTTTGGGATTTCTTCAGTTCCAACAAAAGGTCTGTCATCTGATAACAAACCTATGGTTAACTTGGATAAGCTGAAGGAAAGAGCTCAAAGATTTGGTTTGAATGTCTCTTCAATCTCCAGAAAGTCTGAAGATGATGAGAAACTGAAAAAGAGGAAGGAGCGATTTGGGATTGTCACAAGTTCAGCTGGAACTGGAACCACAGAGGATACAGAGGCAAAGAAGAGGAAAAGAGCAGAGCGCTTTGGGATTGCC

Insert Property: Insert 1

Type Value Extra Information
CDS Start 1
CDS Stop 630
End on reference sequence 654
Start on reference sequence 22

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCATGGCGACCGAGACGGTGGAGCTCCATAAGCTAAAGCTTGCCGAACTAAAGCAAGAATGTCTTGCTCGTGGTTTGGAGACCAAGGGAATAAAGCAAGATCTTATCCACAGACTCCAGGCATATCTTGAAGAACATGCTGAAGAGGAGGCAAATGAAGAAGATGTACTGGGAGATGAAACAGAGGAAGAAGAAACAAAGCCCATTGAGCTCCCTGTCAAAGAGGAAGAACCCCCTGAAAAAACTGTTGATGTGGCAGCAGAGAAGAAAGTGGTGAAAATTACATCTGAAATACCACAGACTGAGAGAATGCAGAAGAGGGCTGAACGATTCAATGTACCTGTGAGCTTGGAGAGTAAGAAAGCTGCTCGGGCAGCTAGGTTTGGGATTTCTTCAGTTCCAACAAAAGGTCTGTCATCTGATAACAAACCTATGGTTAACTTGGATAAGCTGAAGGAAAGAGCTCAAAGATTTGGTTTGAATGTCTCTTCAATCTCCAGAAAGTCTGAAGATGATGAGAAACTGAAAAAGAGGAAGGAGCGATTTGGGATTGTCACAAGTTCAGCTGGAACTGGAACCACAGAGGATACAGAGGCAAAGAAGAGGAAAAGAGCAGAGCGCTTTGGGATTGCCTGCCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGCCTCCTCTAGACCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTACCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAACCCTCGAGCCACCCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT

Vector Information:

Vector Name:pENTR223
Type:bacterial plasmid
Description:Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Properties:recombinational cloning
Comments:Additional information about this vector is available from the commercial website and at the ORFeome website http://www.orfeomecollaboration.org/html/vectors.shtml; also see supplemental figure 1 of the paper PubMed ID 15489335.
Map:pDONR223.1.gif
Sequence:pENTR223-seq.doc
Size (bp):2815
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial spectinomycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL spectinomycin Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.

Authors:

Author Name Author Type
The ORFeome Collaboration Consortium
Center for Cancer Systems Biology Clone donor

Publications:

PMID Title
17207965 hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes.
154893350 Human ORFeome version 1.1: a platform for reverse proteomics.