Clone: HsCD00036034

Clone ID:HsCD00036034
Is Verified:N
Status:AVAILABLE
Source:HIP
Description:
Comments:
Type:cDNA
Verification Method:Insert was fully sequenced in parent vector
Distribution:Academic and non-profit labs
Special MTA:
Map:

Related Identifiers:

HIP Clone ID 227913
HIP Master Clone ID 87378
Original Clone ID FLH227913.01L

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 1398 Homo sapiens FUSION MGC template 2645 GCK glucokinase (hexokinase 4, maturity onset diabetes of the young 2)
Insert1
Size (bp)1398
SpeciesHomo sapiens
FormatFUSION
Tissue SourceMGC template
Species Specific ID 2645
Gene SymbolGCK
Gene Nameglucokinase (hexokinase 4, maturity onset diabetes of the young 2)
Keyword

Insert Sequence:

ATGCTGGACGACAGAGCCAGGATGGAGGCCGCCAAGAAGGAGAAGGTAGAGCAGATCCTGGCAGAGTTCCAGCTGCAGGAGGAGGACCTGAAGAAGGTGATGAGACGGATGCAGAAGGAGATGGACCGCGGCCTGAGGCTGGAGACCCATGAAGAGGCCAGTGTGAAGATGCTGCCCACCTACGTGCGCTCCACCCCAGAAGGCTCAGAAGTCGGGGACTTCCTCTCCCTGGACCTGGGTGGCACTAACTTCAGGGTGATGCTGGTGAAGGTGGGAGAAGGTGAGGAGGGGCAGTGGAGCGTGAAGACCAAACACCAGATGTACTCCATCCCCGAGGACGCCATGACCGGCACTGCTGAGATGCTCTTCGACTACATCTCTGAGTGCATCTCCGACTTCCTGGACAAGCATCAGATGAAACACAAGAAGCTGCCCCTGGGCTTCACCTTCTCCTTTCCTGTGAGGCACGAAGACATCGATAAGGGCATCCTTCTCAACTGGACCAAGGGCTTCAAGGCCTCAGGAGCAGAAGGGAACAATGTCGTGGGGCTTCTGCGAGACGCTATCAAACGGAGAGGGGACTTTGAAATGGATGTGGTGGCAATGGTGAATGACACGGTGGCCACGATGATCTCCTGCTACTACGAAGACCATCAGTGCGAGGTCGGCATGATCGTGGGCACGGGCTGCAATGCCTGCTACATGGAGGAGATGCAGAATGTGGAGCTGGTGGAGGGGGACGAGGGCCGCATGTGCGTCAATACCGAGTGGGGCGCCTTCGGGGACTCCGGCGAGCTGGACGAGTTCCTGCTGGAGTATGACCGCCTGGTGGACGAGAGCTCTGCAAACCCCGGTCAGCAGCTGTATGAGAAGCTCATAGGTGGCAAGTACATGGGCGAGCTGGTGCGGCTTGTGCTGCTCAGGCTCGTGGACGAAAACCTGCTCTTCCACGGGGAGGCCTCCGAGCAGCTGCGCACACGCGGAGCCTTCGAGACGCGCTTCGTGTCGCAGGTGGAGAGCGACACGGGCGACCGCAAGCAGATCTACAACATCCTGAGCACGCTGGGGCTGCGACCCTCGACCACCGACTGCGACATCGTGCGCCGCGCCTGCGAGAGCGTGTCTACGCGCGCTGCGCACATGTGCTCGGCGGGGCTGGCGGGCGTCATCAACCGCATGCGCGAGAGCCGCAGCGAGGACGTAATGCGCATCACTGTGGGCGTGGATGGCTCCGTGTACAAGCTGCACCCCAGCTTCAAGGAGCGGTTCCATGCCAGCGTGCGCAGGCTGACGCCCAGCTGCGAGATCACCTTCATCGAGTCGGAGGAGGGCAGTGGCCGGGGCGCGGCCCTGGTCTCGGCGGTGGCCTGTAAGAAGGCCTGTATGCTGGGCCAGTTG

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 1868
Start on reference sequence 471

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

TAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATCCGCTAGCGCTACCGGTCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTCCGGACTCAGATCTCGAGCTCAAGCTTCGATAACTTCGTATAGCATACATTATACGAAGTTATCAGTCGACACCATGCTGGACGACAGAGCCAGGATGGAGGCCGCCAAGAAGGAGAAGGTAGAGCAGATCCTGGCAGAGTTCCAGCTGCAGGAGGAGGACCTGAAGAAGGTGATGAGACGGATGCAGAAGGAGATGGACCGCGGCCTGAGGCTGGAGACCCATGAAGAGGCCAGTGTGAAGATGCTGCCCACCTACGTGCGCTCCACCCCAGAAGGCTCAGAAGTCGGGGACTTCCTCTCCCTGGACCTGGGTGGCACTAACTTCAGGGTGATGCTGGTGAAGGTGGGAGAAGGTGAGGAGGGGCAGTGGAGCGTGAAGACCAAACACCAGATGTACTCCATCCCCGAGGACGCCATGACCGGCACTGCTGAGATGCTCTTCGACTACATCTCTGAGTGCATCTCCGACTTCCTGGACAAGCATCAGATGAAACACAAGAAGCTGCCCCTGGGCTTCACCTTCTCCTTTCCTGTGAGGCACGAAGACATCGATAAGGGCATCCTTCTCAACTGGACCAAGGGCTTCAAGGCCTCAGGAGCAGAAGGGAACAATGTCGTGGGGCTTCTGCGAGACGCTATCAAACGGAGAGGGGACTTTGAAATGGATGTGGTGGCAATGGTGAATGACACGGTGGCCACGATGATCTCCTGCTACTACGAAGACCATCAGTGCGAGGTCGGCATGATCGTGGGCACGGGCTGCAATGCCTGCTACATGGAGGAGATGCAGAATGTGGAGCTGGTGGAGGGGGACGAGGGCCGCATGTGCGTCAATACCGAGTGGGGCGCCTTCGGGGACTCCGGCGAGCTGGACGAGTTCCTGCTGGAGTATGACCGCCTGGTGGACGAGAGCTCTGCAAACCCCGGTCAGCAGCTGTATGAGAAGCTCATAGGTGGCAAGTACATGGGCGAGCTGGTGCGGCTTGTGCTGCTCAGGCTCGTGGACGAAAACCTGCTCTTCCACGGGGAGGCCTCCGAGCAGCTGCGCACACGCGGAGCCTTCGAGACGCGCTTCGTGTCGCAGGTGGAGAGCGACACGGGCGACCGCAAGCAGATCTACAACATCCTGAGCACGCTGGGGCTGCGACCCTCGACCACCGACTGCGACATCGTGCGCCGCGCCTGCGAGAGCGTGTCTACGCGCGCTGCGCACATGTGCTCGGCGGGGCTGGCGGGCGTCATCAACCGCATGCGCGAGAGCCGCAGCGAGGACGTAATGCGCATCACTGTGGGCGTGGATGGCTCCGTGTACAAGCTGCACCCCAGCTTCAAGGAGCGGTTCCATGCCAGCGTGCGCAGGCTGACGCCCAGCTGCGAGATCACCTTCATCGAGTCGGAGGAGGGCAGTGGCCGGGGCGCGGCCCTGGTCTCGGCGGTGGCCTGTAAGAAGGCCTGTATGCTGGGCCAGTTGATAACTTCGTATAGCATACATTATACGAAGTTATAGATCCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTGGATCCACCGGATCTAGATAACTGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTAACGCGTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTCCTGAGGCGGAAAGAACCAGCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAGATCGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAAGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGAGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCTAGGGGGAGGCTAACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGCAATAAAAAGACAGAATAAAACGCACGGTGTTGGGTCGTTTGTTCATAAACGCGGGGTTCGGTCCCAGGGCTGGCACTCTGTCGATACCCCACCGAGACCCCATTGGGGCCAATACGCCCGCGTTTCTTCCTTTTCCCCACCCCACCCCCCAAGTTCGGGTGAAGGCCCAGGGCTCGCAGCCAACGTCGGGGCGGCAGGCCCTGCCATAGCCTCAGGTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCATGCAT

Vector Information:

Vector Name:pLP-EGFP-C1
Type:bacterial plasmid
Description:Mammalian expression vector with CMV promoter, EGFP tag; kanamycin resistance (neomycin for mammalian selection); recombinational cloning.
Properties:Creator, acceptor (destination), fluorescent marker, mammalian expression, ssDNA production, with tag/fusion/marker
Comments:
Map:pLP-EGFP-C1.pdf
Sequence:pLP-EGFP-C1.txt
Size (bp):4900
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 50ug/mL kanamycin Growth with the single antibiotic in LB at 37 degrees is recommended. Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.

Publications:

PMID Title
15928075 Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.