Clone: HsCD00035960

Clone ID:HsCD00035960
Is Verified:N
Status:AVAILABLE
Source:HIP
Description:
Comments:
Type:cDNA
Verification Method:Insert was fully sequenced in parent vector
Distribution:Academic and non-profit labs
Special MTA:
Map:

Related Identifiers:

HIP Clone ID 227839
HIP Master Clone ID 87263
Original Clone ID FLH227839.01L

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 1575 Homo sapiens FUSION 1st strand cDNA from placenta and brain 2645 GK glycerol kinase
Insert1
Size (bp)1575
SpeciesHomo sapiens
FormatFUSION
Tissue Source1st strand cDNA from placenta and brain
Species Specific ID 2645
Gene SymbolGK
Gene Nameglycerol kinase
Keyword

Insert Sequence:

ATGGCAGCCTCAAAGAAGGCAGTTTTGGGGCCATTGGTGGGGGCGGTGGACCAGGGCACCAGTTCGACGCGCTTTTTGGTTTTCAATTCAAAAACAGCTGAACTACTTAGTCATCATCAAGTAGAAATAAAACAAGAGTTCCCAAGAGAAGGATGGGTGGAACAGGACCCTAAGGAAATTCTACATTCTGTCTATGAGTGTATAGAGAAAACATGTGAGAAACTTGGACAGCTCAATATTGATATTTCCAACATAAAAGCTATTGGTGTCAGCAACCAGAGGGAAACCACTGTAGTCTGGGACAAGATAACTGGAGAGCCTCTCTACAATGCTGTGGTGTGGCTTGATCTAAGAACCCAGTCTACCGTTGAGAGTCTTAGTAAAAGAATTCCAGGAAATAATAACTTTGTCAAGTCCAAGACAGGCCTTCCACTTAGCACTTACTTCAGTGCAGTGAAACTTCGTTGGCTCCTTGACAATGTGAGAAAAGTTCAAAAGGCCGTTGAAGAAAAACGAGCTCTTTTTGGGACTATTGATTCATGGCTTATTTGGAGTTTGACAGGAGGAGTCAATGGAGGTGTCCACTGTACAGATGTAACAAATGCAAGTAGGACTATGCTTTTCAACATTCATTCTTTGGAATGGGATAAACAACTCTGCGAATTTTTTGGAATTCCAATGGAAATTCTTCCAAATGTCCGGAGTTCTTCTGAGATCTATGGCCTAATGAAAGCTGGGGCCTTGGAAGGTGTGCCAATATCTGGGTGTTTAGGGGACCAGTCTGCTGCATTGGTGGGACAAATGTGCTTCCAGATTGGACAAGCCAAAAATACGTATGGAACAGGATGTTTCTTACTATGTAATACAGGCCATAAGTGTGTATTTTCTGATCATGGCCTTCTCACCACAGTGGCTTACAAACTTGGCAGAGACAAACCAGTATATTATGCTTTGGAAGGTTCTGTAGCTATAGCTGGTGCTGTTATTCGCTGGCTAAGAGACAATCTTGGAATTATAAAGACCTCAGAAGAAATTGAAAAACTTGCTAAAGAAGTAGGTACTTCTTATGGCTGCTACTTCGTCCCAGCATTTTCGGGGTTATATGCACCTTATTGGGAGCCCAGCGCAAGAGGGATAATCTGTGGACTCACTCAGTTCACCAATAAATGCCATATTGCTTTTGCTGCATTAGAAGCTGTTTGTTTCCAAACTCGAGAGATTTTGGATGCCATGAATCGAGACTGTGGAATTCCACTCAGTCATTTGCAGGTAGATGGAGGAATGACCAGCAACAAAATTCTTATGCAGCTACAAGCAGACATTCTGTATATACCAGTAGTGAAGCCCTCAATGCCCGAAACCACTGCACTGGGTGCGGCTATGGCGGCAGGGGCTGCAGAAGGAGTCGGCGTATGGAGTCTCGAACCCGAGGATTTGTCTGCCGTCACGATGGAGCGGTTTGAACCTCAGATTAATGCGGAGGAAAGTGAAATTCGTTATTCTACATGGAAGAAAGCTGTGATGAAGTCAATGGGTTGGGTTACAACTCAATCTCCAGAAAGTGGTATTCCATTG

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 1641
Start on reference sequence 67

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

TAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATCCGCTAGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTCGACACCATGGCAGCCTCAAAGAAGGCAGTTTTGGGGCCATTGGTGGGGGCGGTGGACCAGGGCACCAGTTCGACGCGCTTTTTGGTTTTCAATTCAAAAACAGCTGAACTACTTAGTCATCATCAAGTAGAAATAAAACAAGAGTTCCCAAGAGAAGGATGGGTGGAACAGGACCCTAAGGAAATTCTACATTCTGTCTATGAGTGTATAGAGAAAACATGTGAGAAACTTGGACAGCTCAATATTGATATTTCCAACATAAAAGCTATTGGTGTCAGCAACCAGAGGGAAACCACTGTAGTCTGGGACAAGATAACTGGAGAGCCTCTCTACAATGCTGTGGTGTGGCTTGATCTAAGAACCCAGTCTACCGTTGAGAGTCTTAGTAAAAGAATTCCAGGAAATAATAACTTTGTCAAGTCCAAGACAGGCCTTCCACTTAGCACTTACTTCAGTGCAGTGAAACTTCGTTGGCTCCTTGACAATGTGAGAAAAGTTCAAAAGGCCGTTGAAGAAAAACGAGCTCTTTTTGGGACTATTGATTCATGGCTTATTTGGAGTTTGACAGGAGGAGTCAATGGAGGTGTCCACTGTACAGATGTAACAAATGCAAGTAGGACTATGCTTTTCAACATTCATTCTTTGGAATGGGATAAACAACTCTGCGAATTTTTTGGAATTCCAATGGAAATTCTTCCAAATGTCCGGAGTTCTTCTGAGATCTATGGCCTAATGAAAGCTGGGGCCTTGGAAGGTGTGCCAATATCTGGGTGTTTAGGGGACCAGTCTGCTGCATTGGTGGGACAAATGTGCTTCCAGATTGGACAAGCCAAAAATACGTATGGAACAGGATGTTTCTTACTATGTAATACAGGCCATAAGTGTGTATTTTCTGATCATGGCCTTCTCACCACAGTGGCTTACAAACTTGGCAGAGACAAACCAGTATATTATGCTTTGGAAGGTTCTGTAGCTATAGCTGGTGCTGTTATTCGCTGGCTAAGAGACAATCTTGGAATTATAAAGACCTCAGAAGAAATTGAAAAACTTGCTAAAGAAGTAGGTACTTCTTATGGCTGCTACTTCGTCCCAGCATTTTCGGGGTTATATGCACCTTATTGGGAGCCCAGCGCAAGAGGGATAATCTGTGGACTCACTCAGTTCACCAATAAATGCCATATTGCTTTTGCTGCATTAGAAGCTGTTTGTTTCCAAACTCGAGAGATTTTGGATGCCATGAATCGAGACTGTGGAATTCCACTCAGTCATTTGCAGGTAGATGGAGGAATGACCAGCAACAAAATTCTTATGCAGCTACAAGCAGACATTCTGTATATACCAGTAGTGAAGCCCTCAATGCCCGAAACCACTGCACTGGGTGCGGCTATGGCGGCAGGGGCTGCAGAAGGAGTCGGCGTATGGAGTCTCGAACCCGAGGATTTGTCTGCCGTCACGATGGAGCGGTTTGAACCTCAGATTAATGCGGAGGAAAGTGAAATTCGTTATTCTACATGGAAGAAAGCTGTGATGAAGTCAATGGGTTGGGTTACAACTCAATCTCCAGAAAGTGGTATTCCATTGATAACTTCGTATAGCATACATTATACGAAGTTATAGATCCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTGGATCTCGAGCTCAAGCTTCGAATTGGCCGCGACTCTAGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTAAGGCGTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTCCTGAGGCGGAAAGAACCAGCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAGATCGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAAGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGAGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCTAGGGGGAGGCTAACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGCAATAAAAAGACAGAATAAAACGCACGGTGTTGGGTCGTTTGTTCATAAACGCGGGGTTCGGTCCCAGGGCTGGCACTCTGTCGATACCCCACCGAGACCCCATTGGGGCCAATACGCCCGCGTTTCTTCCTTTTCCCCACCCCACCCCCCAAGTTCGGGTGAAGGCCCAGGGCTCGCAGCCAACGTCGGGGCGGCAGGCCCTGCCATAGCCTCAGGTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCATGCAT

Vector Information:

Vector Name:pLP-CMVneo
Type:bacterial plasmid
Description:Mammalian expression vector with CMV promoter; kanamycin resistance (neomycin for mammalian selection); recombinational cloning.
Properties:Creator, acceptor (destination), mammalian expression
Comments:
Map:pLP-CMVneo.pdf
Sequence:
Size (bp):4100
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 50ug/mL kanamycin Growth with the single antibiotic in LB at 37 degrees is recommended. Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.

Publications:

PMID Title
15928075 Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.