Clone: HsCD00348354

Clone ID:HsCD00348354
Is Verified:Y
Status:AVAILABLE
Source:MGC
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

IMAGE ID 100062119
GI 164565455
GenBank Accession BC156674
Original Clone ID MGC:190174

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 3388 Homo sapiens CLOSED 2986 GUCY2F guanylate cyclase 2F, retinal
Insert1
Size (bp)3388
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 2986
Gene SymbolGUCY2F
Gene Nameguanylate cyclase 2F, retinal
Keyword

Insert Sequence:

GTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGTTCCTGGGACTCGGGCGCTTTTCTCGCCTTGTTCTCTGGTTTGCGGCTTTCAGGAAACTGCTGGGACACCATGGCCTTGCATCTGCCAAGTTCCTGTGGTGCTTGTGCCTTCTGTCTGTCATGTCCCTTCCGCAGCAGGTGTGGACACTCCCCTACAAGATAGGGGTGGTGGGCCCTTGGGCTTGTGATTCGCTGTTTTCAAAGGCCCTGCCTGAGGTTGCTGCGCGATTAGCCATTGAGCGAATCAACCGGGACCCATCTTTTGACCTGAGTTATTCTTTTGAATACGTGATTCTCAATGAAGACTGCCAGACTTCGAGGGCTCTCTCCAGTTTCATTTCCCACCACCAGATGGCCTCAGGATTTATTGGACCTACCAACCCTGGCTACTGCGAGGCAGCCTCGCTCCTGGGAAACAGCTGGGACAAAGGAATTTTCTCTTGGGCTTGTGTGAATTATGAATTAGACAATAAAATTAGCTACCCGACCTTTTCTCGGACACTCCCTTCTCCCATCCGGGTGCTTGTAACTGTCATGAAATATTTCCAGTGGGCTCATGCTGGAGTCATTTCCTCAGATGAAGACATTTGGGTGCATACAGCCAATCGAGTCGCAAGTGCTCTTCGGAGCCACGGCTTACCTGTAGGGGTCGTCCTGACCACAGGACAAGACAGCCAAAGCATGCGGAAAGCCCTCCAGAGGATTCACCAGGCAGACAGAATTCGCATAATCATCATGTGTATGCATTCAGCTTTGATTGGGGGAGAGACTCAGATGCATCTCTTGGAATGTGCTCATGATCTGAAAATGACTGATGGAACCTACGTCTTTGTTCCTTATGATGCCCTGCTCTACAGTTTACCTTATAAGCACACCCCCTACCGGGTCCTAAGGAACAACCCAAAGCTCCGGGAAGCCTATGATGCAGTGTTGACCATTACAGTGGAGTCCCAAGAAAAGACCTTCTATCAAGCCTTCACAGAGGCAGCAGCAAGAGGTGAAATTCCTGAGAAGCTGGAGTTCGATCAAGTTTCACCGTTGTTTGGAACCATCTACAATTCAATTTACTTTATCGCACAAGCCATGAATAATGCTATGAAAGAAAATGGACAGGCTGGTGCTGCCAGCCTGGTTCAGCATTCCAGAAACATGCAGTTCCATGGATTCAACCAGTTGATGAGGACAGATTCAAATGGAAATGGAATTTCAGAATATGTAATCCTGGACACCAACTTGAAAGAATGGGAACTCCATAGCACCTACACTGTGGACATGGAAATGGAGCTGCTACGTTTCGGAGGGACCCCTATTCACTTCCCTGGTGGCAGGCCCCCTAGAGCAGATGCAAAATGCTGGTTTGCAGAAGGGAAGATCTGCCATGGAGGCATCGACCCTGCCTTTGCCATGATGGTCTGCCTTACTTTGCTTATAGCCCTGCTGTCTATTAATGGATTTGCTTACTTTATAAGGCGTCGTATAAATAAAATCCAGTTGATCAAAGGACCCAATAGAATTCTACTGACTTTGGAGGATGTAACGTTTATCAATCCCCACTTTGGCAGTAAGAGAGGAAGTCGTGCCAGTGTAAGCTTCCAGATTACCTCAGAGGTCCAAAGTGGGAGGTCCCCAAGACTCTCCTTTTCTTCAGGGAGTCTAACTCCAGCTACCTATGAAAACTCCAACATAGCGATTTATGAGGGTGATTGGGTGTGGCTGAAAAAGTTCTCCCTTGGAGATTTTGGAGACCTTAAGTCCATCAAATCAAGAGCAAGTGATGTGTTCGAAATGATGAAGGACTTGCGTCATGAGAATATTAACCCTTTATTGGGTTTCTTCTATGATTCGGGGATGTTTGCCATTGTGACAGAATTCTGTTCCCGAGGGAGCCTAGAAGACATACTGACAAATCAAGATGTGAAACTTGACTGGATGTTTAAATCATCACTCTTGCTGGATCTCATAAAGGGCATGAAGTACTTACACCACAGAGAGTTTGTTCATGGGAGGCTAAAGTCTCGAAACTGTGTGGTAGATGGGCGTTTTGTACTAAAAGTGACAGATTATGGCTTTAACGACATCTTAGAAATGCTGAGACTCTCTGAAGAGGAATCTTCTATGGAAGAGCTGCTGTGGACGGCCCCTGAACTGTTGAGAGCTCCAAGAGGCAGCAGGTTAGGTTCTTTTGCAGGAGATGTCTATAGCTTTGCCATCATCATGCAAGAAGTGATGGTCCGGGGTACCCCATTCTGCATGATGGATCTGCCAGCTCAAGAAATCATAAACAGACTTAAGAAGCCTCCTCCTGTGTACAGACCAGTAGTTCCTCCTGAGCATGCCCCTCCAGAATGTCTCCAGCTGATGAAGCAGTGCTGGGCTGAGGCTGCAGAACAACGACCAACTTTTGATGAAATATTTAACCAGTTTAAAACTTTTAATAAAGGGAAGAAGACCAATATTATTGATTCTATGCTTCGGATGTTGGAGCAATATTCTAGCAACTTGGAAGATTTGATTCGGGAGCGGACTGAAGAGCTGGAAATTGAAAAACAGAAAACGGAAAAGCTTCTAACACAGATGCTACCACCATCAGTTGCTGAATCTCTCAAAAAGGGCTGCACAGTTGAACCTGAGGGCTTTGACTTGGTCACCTTGTACTTCAGCGACATTGTGGGCTTCACAACCATTTCAGCCATGAGTGAGCCCATTGAGGTCGTGGATCTTCTGAATGACCTGTACACACTCTTTGATGCAATAATTGGCAGTCATGATGTCTACAAGGTAGAGACCATTGGAGATGCCTACATGGTGGCTTCAGGCCTCCCAAAGAGGAATGGCAGTAGGCATGCAGCTGAGATTGCAAACATGTCCTTAGATATCCTGAGCTCTGTGGGCACTTTCAAGATGCGGCACATGCCAGAAGTGCCGGTCCGAATTCGAATTGGCCTTCACTCAGGGCCGGTTGTTGCTGGAGTGGTGGGCCTCACCATGCCCAGATACTGCTTGTTTGGAGACACTGTGAACACAGCTTCTCGGATGGAATCTACAGGCTTACCTTATCGCATTCATGTCAGTCTCAGCACTGTTACAATTCTTCAAAATCTGAGTGAGGGCTATGAAGTGGAGCTTCGAGGAAGAACAGAGCTCAAGGGCAAAGGCACAGAGGAAACCTTCTGGCTGATTGGGAAAAAAGGCTTCATGAAGCCCCTTCCTGTGCCCCCACCAGTGGACAAAGATGGGCAAGTGGGCCATGGCCTGCAACCAGTGGAGATTGCAGCCTTCCAAAGAAGAAAAGCAGAAAGGCAGTTGGTGAGAAACAAGCCATAAGGCCTCATGGGCCCAGCTTTCTTGTAC

Insert Property: Insert 1

Type Value Extra Information
CDS Start 35
CDS Stop 3361

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGTTCCTGGGACTCGGGCGCTTTTCTCGCCTTGTTCTCTGGTTTGCGGCTTTCAGGAAACTGCTGGGACACCATGGCCTTGCATCTGCCAAGTTCCTGTGGTGCTTGTGCCTTCTGTCTGTCATGTCCCTTCCGCAGCAGGTGTGGACACTCCCCTACAAGATAGGGGTGGTGGGCCCTTGGGCTTGTGATTCGCTGTTTTCAAAGGCCCTGCCTGAGGTTGCTGCGCGATTAGCCATTGAGCGAATCAACCGGGACCCATCTTTTGACCTGAGTTATTCTTTTGAATACGTGATTCTCAATGAAGACTGCCAGACTTCGAGGGCTCTCTCCAGTTTCATTTCCCACCACCAGATGGCCTCAGGATTTATTGGACCTACCAACCCTGGCTACTGCGAGGCAGCCTCGCTCCTGGGAAACAGCTGGGACAAAGGAATTTTCTCTTGGGCTTGTGTGAATTATGAATTAGACAATAAAATTAGCTACCCGACCTTTTCTCGGACACTCCCTTCTCCCATCCGGGTGCTTGTAACTGTCATGAAATATTTCCAGTGGGCTCATGCTGGAGTCATTTCCTCAGATGAAGACATTTGGGTGCATACAGCCAATCGAGTCGCAAGTGCTCTTCGGAGCCACGGCTTACCTGTAGGGGTCGTCCTGACCACAGGACAAGACAGCCAAAGCATGCGGAAAGCCCTCCAGAGGATTCACCAGGCAGACAGAATTCGCATAATCATCATGTGTATGCATTCAGCTTTGATTGGGGGAGAGACTCAGATGCATCTCTTGGAATGTGCTCATGATCTGAAAATGACTGATGGAACCTACGTCTTTGTTCCTTATGATGCCCTGCTCTACAGTTTACCTTATAAGCACACCCCCTACCGGGTCCTAAGGAACAACCCAAAGCTCCGGGAAGCCTATGATGCAGTGTTGACCATTACAGTGGAGTCCCAAGAAAAGACCTTCTATCAAGCCTTCACAGAGGCAGCAGCAAGAGGTGAAATTCCTGAGAAGCTGGAGTTCGATCAAGTTTCACCGTTGTTTGGAACCATCTACAATTCAATTTACTTTATCGCACAAGCCATGAATAATGCTATGAAAGAAAATGGACAGGCTGGTGCTGCCAGCCTGGTTCAGCATTCCAGAAACATGCAGTTCCATGGATTCAACCAGTTGATGAGGACAGATTCAAATGGAAATGGAATTTCAGAATATGTAATCCTGGACACCAACTTGAAAGAATGGGAACTCCATAGCACCTACACTGTGGACATGGAAATGGAGCTGCTACGTTTCGGAGGGACCCCTATTCACTTCCCTGGTGGCAGGCCCCCTAGAGCAGATGCAAAATGCTGGTTTGCAGAAGGGAAGATCTGCCATGGAGGCATCGACCCTGCCTTTGCCATGATGGTCTGCCTTACTTTGCTTATAGCCCTGCTGTCTATTAATGGATTTGCTTACTTTATAAGGCGTCGTATAAATAAAATCCAGTTGATCAAAGGACCCAATAGAATTCTACTGACTTTGGAGGATGTAACGTTTATCAATCCCCACTTTGGCAGTAAGAGAGGAAGTCGTGCCAGTGTAAGCTTCCAGATTACCTCAGAGGTCCAAAGTGGGAGGTCCCCAAGACTCTCCTTTTCTTCAGGGAGTCTAACTCCAGCTACCTATGAAAACTCCAACATAGCGATTTATGAGGGTGATTGGGTGTGGCTGAAAAAGTTCTCCCTTGGAGATTTTGGAGACCTTAAGTCCATCAAATCAAGAGCAAGTGATGTGTTCGAAATGATGAAGGACTTGCGTCATGAGAATATTAACCCTTTATTGGGTTTCTTCTATGATTCGGGGATGTTTGCCATTGTGACAGAATTCTGTTCCCGAGGGAGCCTAGAAGACATACTGACAAATCAAGATGTGAAACTTGACTGGATGTTTAAATCATCACTCTTGCTGGATCTCATAAAGGGCATGAAGTACTTACACCACAGAGAGTTTGTTCATGGGAGGCTAAAGTCTCGAAACTGTGTGGTAGATGGGCGTTTTGTACTAAAAGTGACAGATTATGGCTTTAACGACATCTTAGAAATGCTGAGACTCTCTGAAGAGGAATCTTCTATGGAAGAGCTGCTGTGGACGGCCCCTGAACTGTTGAGAGCTCCAAGAGGCAGCAGGTTAGGTTCTTTTGCAGGAGATGTCTATAGCTTTGCCATCATCATGCAAGAAGTGATGGTCCGGGGTACCCCATTCTGCATGATGGATCTGCCAGCTCAAGAAATCATAAACAGACTTAAGAAGCCTCCTCCTGTGTACAGACCAGTAGTTCCTCCTGAGCATGCCCCTCCAGAATGTCTCCAGCTGATGAAGCAGTGCTGGGCTGAGGCTGCAGAACAACGACCAACTTTTGATGAAATATTTAACCAGTTTAAAACTTTTAATAAAGGGAAGAAGACCAATATTATTGATTCTATGCTTCGGATGTTGGAGCAATATTCTAGCAACTTGGAAGATTTGATTCGGGAGCGGACTGAAGAGCTGGAAATTGAAAAACAGAAAACGGAAAAGCTTCTAACACAGATGCTACCACCATCAGTTGCTGAATCTCTCAAAAAGGGCTGCACAGTTGAACCTGAGGGCTTTGACTTGGTCACCTTGTACTTCAGCGACATTGTGGGCTTCACAACCATTTCAGCCATGAGTGAGCCCATTGAGGTCGTGGATCTTCTGAATGACCTGTACACACTCTTTGATGCAATAATTGGCAGTCATGATGTCTACAAGGTAGAGACCATTGGAGATGCCTACATGGTGGCTTCAGGCCTCCCAAAGAGGAATGGCAGTAGGCATGCAGCTGAGATTGCAAACATGTCCTTAGATATCCTGAGCTCTGTGGGCACTTTCAAGATGCGGCACATGCCAGAAGTGCCGGTCCGAATTCGAATTGGCCTTCACTCAGGGCCGGTTGTTGCTGGAGTGGTGGGCCTCACCATGCCCAGATACTGCTTGTTTGGAGACACTGTGAACACAGCTTCTCGGATGGAATCTACAGGCTTACCTTATCGCATTCATGTCAGTCTCAGCACTGTTACAATTCTTCAAAATCTGAGTGAGGGCTATGAAGTGGAGCTTCGAGGAAGAACAGAGCTCAAGGGCAAAGGCACAGAGGAAACCTTCTGGCTGATTGGGAAAAAAGGCTTCATGAAGCCCCTTCCTGTGCCCCCACCAGTGGACAAAGATGGGCAAGTGGGCCATGGCCTGCAACCAGTGGAGATTGCAGCCTTCCAAAGAAGAAAAGCAGAAAGGCAGTTGGTGAGAAACAAGCCATAAGGCCTCATGGGCCCAGCTTTCTTGTACTACAAAGTTGGCATTATAAAAAATAATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGCCTCCTCTAGACCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTGCCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAACCCTCGAGCCACCCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCG

Sequencing Information:

Phred Score: 809
Date: 2015-10-13

Last Passing Sequencing Read:

CCGCATAGATTTATTTTGACTGAAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGTTCCTGGGACTCGGGCGCTTTTCTCGCCTTGTTCTCTGGTTTGCGGCTTTCAGGAAACTGCTGGGACACCATGGCCTTGCATCTGCCAAGTTCCTGTGGTGCTTGTGCCTTCTGTCTGTCATGTCCCTTCCGCAGCAGGTGTGGACACTCCCCTACAAGATAGGGGTGGTGGGCCCTTGGGCTTGTGATTCGCTGTTTTCAAAGGCCCTGCCTGAGGTTGCTGCGCGATTAGCCATTGAGCGAATCAACCGGGACCCATCTTTTGACCTGAGTTATTCTTTTGAATACGTGATTCTCAATGAAGACTGCCAGACTTCGAGGGCTCTCTCCAGTTTCATTTCCCACCACCAGATGGCCTCAGGATTTATTGGACCTACCAACCCTGGCTACTGCGAGGCAGCCTCGCTCCTGGGAAACAGCTGGGACAAAGGAATTTTCTCTTGGGCTTGTGTGAATTATGAATTAGACAATAAAATTAGCTACCCGACCTTTTCTCGGACACTCCCTTCTCCCATCCGGGTGCTTGTAACTGTCATGAAATATTTCCAGTGGGCTCATGCTGGAGTCATTTCCTCAGATGAAGACATTTGGGTGCATACAGCCAATCGAGTCGCAAGTGCTCTTCGGAGCCACGGCTTACCTGTAGGGGTCGTCCTGACCACAGGACAAGACAGCCAAAGCATGCGGAAAGCCCTCCAGAGGATTCACCAGGCAGACAGAATTCGCATAATCATCATGTGTATGCATTCAGCTTTGATTGGGGGAGAGACTCAGATGCATCTCTTGGAATGTGCTCATGAACTGAAAATGACTGATGGAACCTACGTCTTTGTTCCTTATGATGCACTGCTCTAAAGTTTTCCTTTAAAACACACCCCCTACCGGGTCCCTAAGGACAACCCCAAGCTCCCGGAAGCCTATGATGCAGGTGTGACATTACAGTGAAATCCAAGTAAAAACTTCTAATAGCCTTCCCAAAGCCGCACAAGAGGTAAATTCCTGAAAACTGGATTCGATCAATTTCCCCGTGGTTGGAACATCTACAATTTATTCATTTTTCCCACACCCATGAAATGCTTTAATAAAATGCACAGGGGGGCTGCCACCTGGTCAAATCCAAAACTGCATTCCTGGTTCCCCGTGTGGAGCACATTCAAGAAGGGATTTCAAATTTATCTGGCCCCCTTGAAAAGGACCCCCCCCCACCGTGAAGGAAAGAGTCCCCTTGGAGGACCCTTCTTCTGTGGGCCCCTAAAAACAATTGTTAAAGAAATCCGGAGACACCCCTCAAGGGCCCTTTTTCCCGCTTTTGTGTTTTTGGGCAATAACATAA

Vector Information:

Vector Name:pENTR223.1
Type:bacterial plasmid
Description:Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Properties:Gateway, donor (entry), recombinational cloning
Comments:Additional information about this vector is available from the commercial website and at the ORFeome website http://www.orfeomecollaboration.org/html/vectors.shtml.
Map:pENTR223-1-map.doc
Sequence:pENTR223_1.txt
Size (bp):4311
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
Mach1 T1-R Y E. coli Mach1 bacterial host strain with T1 phage resistance

Antibiotic Selections:

Host Type Marker
bacterial spectinomycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL spectinomycin Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.

Authors:

Author Name Author Type
MGC Consortium