Clone: HsCD00348280

Clone ID:HsCD00348280
Is Verified:Y
Status:AVAILABLE
Source:MGC
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

IMAGE ID 100061644
GI 162317629
GenBank Accession BC156244
Original Clone ID MGC:190062

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 772 Homo sapiens FUSION 11219 TREX2 three prime repair exonuclease 2
Insert1
Size (bp)772
SpeciesHomo sapiens
FormatFUSION
Tissue Source
Species Specific ID 11219
Gene SymbolTREX2
Gene Namethree prime repair exonuclease 2
Keyword

Insert Sequence:

GTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGTCCGAGGCACCCCGGGCCGAGACCTTTGTCTTCCTGGACCTGGAAGCCACTGGGCTCCCCAGTGTGGAGCCCGAGATTGCCGAGCTGTCCCTCTTTGCTGTCCACCGCTCCTCCCTGGAGAACCCGGAGCACGACGAGTCTGGTGCCCTAGTATTGCCCCGGGTCCTGGACAAGCTCACGCTGTGCATGTGCCCGGAGCGCCCCTTCACTGCCAAGGCCAGCGAGATCACCGGCCTGAGCAGTGAGGGCCTGGCGCGATGCCGGAAGGCTGGCTTTGATGGCGCCGTGGTGCGGACGCTGCAGGCCTTCCTGAGCCGCCAGGCAGGGCCCATCTGCCTTGTGGCCCACAATGGCTTTGATTATGATTTCCCCCTGCTGTGTGCCGAGCTGCGGCGCCTGGGTGCCCGCCTGCCCCGGGACACTGTCTGCCTGGACACGCTGCCGGCCCTGCGGGGCCTGGACCGCGCCCACAGCCACGGCACCCGGGCCCGGGGCCGCCAGGGTTACAGCCTCGGCAGCCTCTTCCACCGCTACTTCCGGGCAGAGCCAAGCGCAGCCCACTCAGCCGAGGGCGACGTGCACACCCTGCTCCTGATCTTCCTGCACCGCGCCGCAGAGCTGCTCGCCTGGGCCGATGAGCAGGCCCGTGGGTGGGCCCACATCGAGCCCATGTACTTGCCGCCTGATGACCCCAGCCTGGAGGCCTCAGGCCTCATGGGCCCAGCTTTCTTGTAC

Insert Property: Insert 1

Type Value Extra Information
CDS Start 35
CDS Stop 742

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGTCCGAGGCACCCCGGGCCGAGACCTTTGTCTTCCTGGACCTGGAAGCCACTGGGCTCCCCAGTGTGGAGCCCGAGATTGCCGAGCTGTCCCTCTTTGCTGTCCACCGCTCCTCCCTGGAGAACCCGGAGCACGACGAGTCTGGTGCCCTAGTATTGCCCCGGGTCCTGGACAAGCTCACGCTGTGCATGTGCCCGGAGCGCCCCTTCACTGCCAAGGCCAGCGAGATCACCGGCCTGAGCAGTGAGGGCCTGGCGCGATGCCGGAAGGCTGGCTTTGATGGCGCCGTGGTGCGGACGCTGCAGGCCTTCCTGAGCCGCCAGGCAGGGCCCATCTGCCTTGTGGCCCACAATGGCTTTGATTATGATTTCCCCCTGCTGTGTGCCGAGCTGCGGCGCCTGGGTGCCCGCCTGCCCCGGGACACTGTCTGCCTGGACACGCTGCCGGCCCTGCGGGGCCTGGACCGCGCCCACAGCCACGGCACCCGGGCCCGGGGCCGCCAGGGTTACAGCCTCGGCAGCCTCTTCCACCGCTACTTCCGGGCAGAGCCAAGCGCAGCCCACTCAGCCGAGGGCGACGTGCACACCCTGCTCCTGATCTTCCTGCACCGCGCCGCAGAGCTGCTCGCCTGGGCCGATGAGCAGGCCCGTGGGTGGGCCCACATCGAGCCCATGTACTTGCCGCCTGATGACCCCAGCCTGGAGGCCTCAGGCCTCATGGGCCCAGCTTTCTTGTACTACAAAGTTGGCATTATAAAAAATAATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGCCTCCTCTAGACCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTGCCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAACCCTCGAGCCACCCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCG

Vector Information:

Vector Name:pENTR223.1
Type:bacterial plasmid
Description:Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Properties:Gateway, donor (entry), recombinational cloning
Comments:Additional information about this vector is available from the commercial website and at the ORFeome website http://www.orfeomecollaboration.org/html/vectors.shtml.
Map:pENTR223-1-map.doc
Sequence:pENTR223_1.txt
Size (bp):4311
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
Mach1 T1-R Y E. coli Mach1 bacterial host strain with T1 phage resistance

Antibiotic Selections:

Host Type Marker
bacterial spectinomycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL spectinomycin Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.

Authors:

Author Name Author Type
MGC Consortium