Clone: HsCD00347159

Clone ID:HsCD00347159
Is Verified:Y
Status:AVAILABLE
Source:MGC
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

IMAGE ID 40073370
GI 141797010
GenBank Accession BC139731
Original Clone ID MGC:134938

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 5775 Homo sapiens CLOSED 8826 IQGAP1 IQ motif containing GTPase activating protein 1
Insert1
Size (bp)5775
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 8826
Gene SymbolIQGAP1
Gene NameIQ motif containing GTPase activating protein 1
Keyword

Insert Sequence:

TCCAAGGTTTCACGGCTTCCTCAGCAGAGACTCGGGCTCGTCCGCCATGTCCGCCGCAGACGAGGTTGACGGGCTGGGCGTGGCCCGGCCGCACTATGGCTCTGTCCTGGATAATGAAAGACTTACTGCAGAGGAGATGGATGAAAGGAGACGTCAGAACGTGGCTTATGAGTACCTTTGTCATTTGGAAGAAGCGAAGAGGTGGATGGAAGCATGCCTAGGGGAAGATCTGCCTCCCACCACAGAACTGGAGGAGGGGCTTAGGAATGGGGTCTACCTTGCCAAACTGGGGAACTTCTTCTCTCCCAAAGTAGTGTCCCTGAAAAAAATCTATGATCGAGAACAGACCAGATACAAGGCGACTGGCCTCCACTTTAGACACACTGATAATGTGATTCAGTGGTTGAATGCCATGGATGAGATTGGATTGCCTAAGATTTTTTACCCAGAAACTACAGATATCTATGATCGAAAGAACATGCCAAGATGTATCTACTGTATCCATGCACTCAGTTTGTACCTGTTCAAGCTAGGCCTGGCCCCTCAGATTCAAGACCTATATGGAAAGGTTGACTTCACAGAAGAAGAAATCAACAACATGAAGACTGAGTTGGAGAAGTATGGCATCCAGATGCCTGCCTTTAGCAAGATTGGGGGCATCTTGGCTAATGAACTGTCAGTGGATGAAGCCGCATTACATGCTGCTGTTATTGCTATTAATGAAGCTATTGACCGTAGAATTCCAGCCGACACATTTGCAGCTTTGAAAAATCCGAATGCCATGCTTGTAAATCTTGAAGAGCCCTTGGCATCCACTTACCAGGATATACTTTACCAGGCTAAGCAGGACAAAATGACAAATGCTAAAAACAGGACAGAAAACTCAGAGAGAGAAAGAGATGTTTATGAGGAGCTGCTCACGCAAGCTGAAATTCAAGGCAATATAAACAAAGTCAATACATTTTCTGCATTAGCAAATATCGACCTGGCTTTAGAACAAGGAGATGCACTGGCCTTGTTCAGGGCTCTGCAGTCACCAGCCCTGGGGCTTCGAGGACTGCAGCAACAGAATAGCGACTGGTACTTGAAGCAGCTCCTGAGTGATAAACAGCAGAAGAGACAGAGTGGTCAGACTGACCCCCTGCAGAAGGAGGAGCTGCAGTCTGGAGTGGATGCTGCAAACAGTGCTGCCCAGCAATATCAGAGAAGATTGGCAGCAGTAGCACTGATTAATGCTGCAATCCAGAAGGGTGTTGCTGAGAAGACTGTTTTGGAACTGATGAATCCCGAAGCCCAGCTGCCCCAGGTGTATCCATTTGCCGCCGATCTCTATCAGAAGGAGCTGGTTACCCTGCAGCGACAAAGTCCTGAACATAATCTCACCCACCCAGAGCTCTCTGTCGCAGTGGAGATGTTGTCATCGGTGGCCCTGATCAACAGGGCATTGGAATCAGGAGATGTGAATACAGTGTGGAAGCAATTGAGCAGTTCAGTTACTGGTCTTACCAATATTGAGGAAGAAAACTGTCAGAGGTATCTCGATGAGTTGATGAAACTGAAGGCTCAGGCACATGCAGAGAATAATGAATTCATTACATGGAATGATATCCAAGCTTGCGTGGACCATGTGAACCTGGTGGTGCAAGAGGAACATGAGAGGATTTTAGCCATTGGTTTAATTAATGAAGCCCTGGATGAAGGTGATGCCCAAAAGACTCTGCAGGCCCTACAGATTCCTGCAGCTAAACTTGAGGGAGTCCTTGCAGAAGTGGCCCAGCATTACCAAGACACGCTGATTAGAGCGAAGAGAGAGAAAGCCCAGGAAATCCAGGATGAGTCAGCTGTGTTATGGTTGGATGAAATTCAAGGTGGAATCTGGCAGTCCAACAAAGACACCCAAGAAGCACAGAAGTTTGCCTTAGGAATCTTTGCCATTAATGAGGCAGTAGAAAGTGGTGATGTTGGCAAAACACTGAGTGCCCTTCGCTCCCCTGATGTTGGCTTGTATGGAGTCATCCCTGAGTGTGGTGAAACTTACCACAGTGATCTTGCTGAAGCCAAGAAGAAAAAACTGGCAGTAGGAGATAATAACAGCAAGTGGGTGAAGCACTGGGTAAAAGGTGGATATTATTATTACCACAATCTGGAGACCCAGGAAGGAGGATGGGATGAACCCCCAAATTTTGTGCAAAATTCTATGCAGCTTTCTCGGGAGGAGATCCAGAGTTCTATCTCTGGGGTGACTGCCGCATATAACCGAGAACAGCTGTGGCTGGCCAATGAAGGCCTGATCACCAGGCTGCAGGCTCGCTGCCGTGGATACTTAGTTCGACAGGAATTCCGATCCAGGATGAATTTCCTGAAGAAACAAATCCCTGCCATCACCTGCATTCAGTCACAGTGGAGAGGATACAAGCAGAAGAAGGCATATCAAGATCGGTTAGCTTACCTGCGCTCCCACAAAGATGAAGTTGTAAAGATTCAGTCCCTGGCAAGGATGCACCAAGCTCGAAAGCGCTATCGAGATCGCCTGCAGTACTTCCGGGACCATATAAATGACATTATCAAAATCCAGGCTTTTATTCGGGCAAACAAAGCTCGGGATGACTACAAGACTCTCATCAATGCTGAGGATCCTCCTATGGTTGTGGTCCGAAAATTTGTCCACCTGCTGGACCAAAGTGACCAGGATTTTCAGGAGGAGCTTGACCTTATGAAGATGCGGGAAGAGGTTATCACCCTCATTCGTTCTAACCAGCAGCTGGAGAATGACCTCAATCTCATGGATATCAAAATTGGACTGCTAGTGAAAAATAAGATTACGTTGCAGGATGTGGTTTCCCACAGTAAAAAACTTACCAAAAAAAATAAGGAACAGTTGTCTGATATGATGATGATAAATAAACAGAAGGGAGGTCTCAAGGCTTTGAGCAAGGAGAAGAGAGAGAAGTTGGAAGCTTACCAGCACCTGTTTTATTTATTGCAAACCAATCCCACCTATCTGGCCAAGCTCATTTTTCAGATGCCCCAGAACAAGTCCACCAAGTTCATGGACTCTGTAATCTTCACACTCTACAACTACGCGTCCAACCAGCGAGAGGAGTACCTGCTCCTGCGGCTCTTTAAGACAGCACTCCAAGAGGAAATCAAGTCGAAGGTAGATCAGATTCAAGAGATTGTGACAGGAAATCCTACGGTTATTAAAATGGTTGTAAGTTTCAACCGTGGTGCCCGTGGCCAGAATGCCCTGAGACAGATCTTGGCCCCAGTCGTGAAGGAAATTATGGATGACAAATCTCTCAACATCAAAACTGACCCTGTGGATATTTACAAATCTTGGGTTAATCAGATGGAGTCTCAGACAGGAGAGGCAAGCAAACTGCCCTATGATGTGACCCCTGAGCAGGCGCTAGCTCATGAAGAAGTGAAGACACGGCTAGACAGCTCCATCAGGAACATGCGGGCTGTGACAGACAAGTTTCTCTCAGCCATTGTCAGCTCTGTGGACAAAATCCCTTATGGGATGCGCTTCATTGCCAAAGTGCTGAAGGACTCGTTGCATGAGAAGTTCCCTGATGCTGGTGAGGATGAGCTGCTGAAGATTATTGGTAACTTGCTTTATTATCGATACATGAATCCAGCCATTGTTGCTCCTGATGCCTTTGACATCATTGACCTGTCAGCAGGAGGCCAGCTTACCACAGACCAACGCCGAAATCTGGGCTCCATTGCAAAAATGCTTCAGCATGCTGCTTCCAATAAGATGTTTCTGGGAGATAATGCCCACTTAAGCATCATTAATGAATATCTTTCCCAGTCCTACCAGAAATTCAGACGGTTTTTCCAAACTGCTTGTGATGTCCCAGAGCTTCAGGATAAATTTAATGTGGATGAGTACTCTGATTTAGTAACCCTCACCAAACCAGTAATCTACATTTCCATTGGTGAAATCATCAACACCCACACTCTCCTGTTGGATCACCAGGATGCCATTGCTCCG GAGCACAATGATCCAATCCACGAACTGCTGGACGACCTCGGCGAGGTGCCCACCATCGAGTCCCTGATAGGGGAAAGCTCTGGCAATTTAAATGACCCAAATAAGGAGGCACTGGCTAAGACGGAAGTGTCTCTCACCCTGACCAACAAGTTCGACGTGCCTGGAGATGAGAATGCAGAAATGGATGCTCGAACCATCTTACTGAATACAAAACGTTTAATTGTGGATGTCATCCGGTTCCAGCCAGGAGAGACCTTGACTGAAATCCTAGAAACACCAGCCACCAGTGAACAGGAAGCAGAACATCAGAGAGCCATGCAGAGACGTGCTATCCGTGATGCCAAAACACCTGACAAGATGAAAAAGTCAAAATCTGTAAAGGAAGACAGCAACCTCACTCTTCAAGAGAAGAAAGAGAAGATCCAGACAGGTTTAAAGAAGCTAACAGAGCTTGGAACCGTGGACCCAAAGAACAAATACCAGGAACTGATCAACGACATTGCCAGGGATATTCGGAATCAGCGGAGGTACCGACAGAGGAGAAAGGCCGAACTAGTGAAACTGCAACAGACATACGCTGCTCTGAACTCTAAGGCCACCTTTTATGGGGAGCAGGTGGATTACTATAAAAGCTATATCAAAACCTGCTTGGATAACTTAGCCAGCAAGGGCAAAGTCTCCAAAAAGCCTAGGGAAATGAAAGGAAAGAAAAGCAAAAAGATTTCTCTGAAATATACAGCAGCAAGACTACATGAAAAAGGAGTTCTTCTGGAAATTGAGGACCTGCAAGTGAATCAGTTTAAAAATGTTATATTTGAAATCAGTCCAACAGAAGAAGTTGGAGACTTCGAAGTGAAAGCCAAATTCATGGGAGTTCAAATGGAGACTTTTATGTTACATTATCAGGACCTGCTGCAGCTACAGTATGAAGGAGTTGCAGTCATGAAATTATTTGATAGAGCTAAAGTAAATGTCAACCTCCTGATCTTCCTTCTCAACAAAAAGTTCTACGGGAAGTAATTGATCGTTTGCTGCCAGCCCAGAAGGATGAAGGAAAGAAGCACCTCACAGCTCCTTTCTAGGTCCTTCTTTCCTCATTGGAAGCAAAGACCTAGCCAACAACAGCACCTCAATCTGATACACTCCCGATGCCACATTTTTAACTCCTCTCGCTCTGATGGGACATTTGTTACCCTTTTTTCATAGTGAAATTGTGTTTCAGGCTTAGTCTGACCTTTCTGGTTTCTTCATTTTCTTCCATTACTTAGGAAAGAGTGGAAACTCCACTAAAATTTCTCTGTGTTGTTACAGTCTTAGAGGTTGCAGTACTATATTGTAAGCTTTGGTGTTTGTTTAATTAGCAATAGGGATGGTAGGATTCAAATGTGTGTCATTTAGAAGTGGAAGCTATTAGCACCAATGACATAAATACATACAAGACACACAACTAAAATGTCATGTTATTAACAGTTATTAGGTTGTCATTTAAAAATAAAGTTCCTTTATATTTCTGTCCCATCAGGAAAACTGAAGGATATGGGGAATCATTGGTTATCTTCCATTGTGTTTTTCTTTATGGACAGGAGCTAATGGAAGTGACAGTCATGTTCAAAGGAAGCATTTCTAGAAAAAAGGAGATAATGTTTTTAAATTTCATTATCAAACTTGGGCAATTCTGTTTGTGTAACTCCCCGACTAGTGGATGGGAGAGTCCCATTGCTAAAATTCAGCTACTCAGATAAATTCAGAATGGGTCAAGGCACCTGCGAAGAGCG

Insert Property: Insert 1

Type Value Extra Information
CDS Start 47
CDS Stop 5020

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

AGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGGCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTATTTAGGTGACACTATAGAATACTCAAGCTATGCATCAAGCTTGGTACCGAGCTCGGATCCACTAGTAACGGCCGCCAGTGTGCTGGAATTCGCCCTTTCCAAGGTTTCACGGCTTCCTCAGCAGAGACTCGGGCTCGTCCGCCATGTCCGCCGCAGACGAGGTTGACGGGCTGGGCGTGGCCCGGCCGCACTATGGCTCTGTCCTGGATAATGAAAGACTTACTGCAGAGGAGATGGATGAAAGGAGACGTCAGAACGTGGCTTATGAGTACCTTTGTCATTTGGAAGAAGCGAAGAGGTGGATGGAAGCATGCCTAGGGGAAGATCTGCCTCCCACCACAGAACTGGAGGAGGGGCTTAGGAATGGGGTCTACCTTGCCAAACTGGGGAACTTCTTCTCTCCCAAAGTAGTGTCCCTGAAAAAAATCTATGATCGAGAACAGACCAGATACAAGGCGACTGGCCTCCACTTTAGACACACTGATAATGTGATTCAGTGGTTGAATGCCATGGATGAGATTGGATTGCCTAAGATTTTTTACCCAGAAACTACAGATATCTATGATCGAAAGAACATGCCAAGATGTATCTACTGTATCCATGCACTCAGTTTGTACCTGTTCAAGCTAGGCCTGGCCCCTCAGATTCAAGACCTATATGGAAAGGTTGACTTCACAGAAGAAGAAATCAACAACATGAAGACTGAGTTGGAGAAGTATGGCATCCAGATGCCTGCCTTTAGCAAGATTGGGGGCATCTTGGCTAATGAACTGTCAGTGGATGAAGCCGCATTACATGCTGCTGTTATTGCTATTAATGAAGCTATTGACCGTAGAATTCCAGCCGACACATTTGCAGCTTTGAAAAATCCGAATGCCATGCTTGTAAATCTTGAAGAGCCCTTGGCATCCACTTACCAGGATATACTTTACCAGGCTAAGCAGGACAAAATGACAAATGCTAAAAACAGGACAGAAAACTCAGAGAGAGAAAGAGATGTTTATGAGGAGCTGCTCACGCAAGCTGAAATTCAAGGCAATATAAACAAAGTCAATACATTTTCTGCATTAGCAAATATCGACCTGGCTTTAGAACAAGGAGATGCACTGGCCTTGTTCAGGGCTCTGCAGTCACCAGCCCTGGGGCTTCGAGGACTGCAGCAACAGAATAGCGACTGGTACTTGAAGCAGCTCCTGAGTGATAAACAGCAGAAGAGACAGAGTGGTCAGACTGACCCCCTGCAGAAGGAGGAGCTGCAGTCTGGAGTGGATGCTGCAAACAGTGCTGCCCAGCAATATCAGAGAAGATTGGCAGCAGTAGCACTGATTAATGCTGCAATCCAGAAGGGTGTTGCTGAGAAGACTGTTTTGGAACTGATGAATCCCGAAGCCCAGCTGCCCCAGGTGTATCCATTTGCCGCCGATCTCTATCAGAAGGAGCTGGTTACCCTGCAGCGACAAAGTCCTGAACATAATCTCACCCACCCAGAGCTCTCTGTCGCAGTGGAGATGTTGTCATCGGTGGCCCTGATCAACAGGGCATTGGAATCAGGAGATGTGAATACAGTGTGGAAGCAATTGAGCAGTTCAGTTACTGGTCTTACCAATATTGAGGAAGAAAACTGTCAGAGGTATCTCGATGAGTTGATGAAACTGAAGGCTCAGGCACATGCAGAGAATAATGAATTCATTACATGGAATGATATCCAAGCTTGCGTGGACCATGTGAACCTGGTGGTGCAAGAGGAACATGAGAGGATTTTAGCCATTGGTTTAATTAATGAAGCCCTGGATGAAGGTGATGCCCAAAAGACTCTGCAGGCCCTACAGATTCCTGCAGCTAAACTTGAGGGAGTCCTTGCAGAAGTGGCCCAGCATTACCAAGACACGCTGATTAGAGCGAAGAGAGAGAAAGCCCAGGAAATCCAGGATGAGTCAGCTGTGTTATGGTTGGATGAAATTCAAGGTGGAATCTGGCAGTCCAACAAAGACACCCAAGAAGCACAGAAGTTTGCCTTAGGAATCTTTGCCATTAATGAGGCAGTAGAAAGTGGTGATGTTGGCAAAACACTGAGTGCCCTTCGCTCCCCTGATGTTGGCTTGTATGGAGTCATCCCTGAGTGTGGTGAAACTTACCACAGTGATCTTGCTGAAGCCAAGAAGAAAAAACTGGCAGTAGGAGATAATAACAGCAAGTGGGTGAAGCACTGGGTAAAAGGTGGATATTATTATTACCACAATCTGGAGACCCAGGAAGGAGGATGGGATGAACCCCCAAATTTTGTGCAAAATTCTATGCAGCTTTCTCGGGAGGAGATCCAGAGTTCTATCTCTGGGGTGACTGCCGCATATAACCGAGAACAGCTGTGGCTGGCCAATGAAGGCCTGATCACCAGGCTGCAGGCTCGCTGCCGTGGATACTTAGTTCGACAGGAATTCCGATCCAGGATGAATTTCCTGAAGAAACAAATCCCTGCCATCACCTGCATTCAGTCACAGTGGAGAGGATACAAGCAGAAGAAGGCATATCAAGATCGGTTAGCTTACCTGCGCTCCCACAAAGATGAAGTTGTAAAGATTCAGTCCCTGGCAAGGATGCACCAAGCTCGAAAGCGCTATCGAGATCGCCTGCAGTACTTCCGGGACCATATAAATGACATTATCAAAATCCAGGCTTTTATTCGGGCAAACAAAGCTCGGGATGACTACAAGACTCTCATCAATGCTGAGGATCCTCCTATGGTTGTGGTCCGAAAATTTGTCCACCTGCTGGACCAAAGTGACCAGGATTTTCAGGAGGAGCTTGACCTTATGAAGATGCGGGAAGAGGTTATCACCCTCATTCGTTCTAACCAGCAGCTGGAGAATGACCTCAATCTCATGGATATCAAAATTGGACTGCTAGTGAAAAATAAGATTACGTTGCAGGATGTGGTTTCCCACAGTAAAAAACTTACCAAAAAAAATAAGGAACAGTTGTCTGATATGATGATGATAAATAAACAGAAGGGAGGTCTCAAGGCTTTGAGCAAGGAGAAGAGAGAGAAGTTGGAAGCTTACCAGCACCTGTTTTATTTATTGCAAACCAATCCCACCTATCTGGCCAAGCTCATTTTTCAGATGCCCCAGAACAAGTCCACCAAGTTCATGGACTCTGTAATCTTCACACTCTACAACTACGCGTCCAACCAGCGAGAGGAGTACCTGCTCCTGCGGCTCTTTAAGACAGCACTCCAAGAGGAAATCAAGTCGAAGGTAGATCAGATTCAAGAGATTGTGACAGGAAATCCTACGGTTATTAAAATGGTTGTAAGTTTCAACCGTGGTGCCCGTGGCCAGAATGCCCTGAGACAGATCTTGGCCCCAGTCGTGAAGGAAATTATGGATGACAAATCTCTCAACATCAAAACTGACCCTGTGGATATTTACAAATCTTGGGTTAATCAGATGGAGTCTCAGACAGGAGAGGCAAGCAAACTGCCCTATGATGTGACCCCTGAGCAGGCGCTAGCTCATGAAGAAGTGAAGACACGGCTAGACAGCTCCATCAGGAACATGCGGGCTGTGACAGACAAGTTTCTCTCAGCCATTGTCAGCTCTGTGGACAAAATCCCTTATGGGATGCGCTTCATTGCCAAAGTGCTGAAGGACTCGTTGCATGAGAAGTTCCCTGATGCTGGTGAGGATGAGCTGCTGAAGATTATTGGTAACTTGCTTTATTATCGATACATGAATCCAGCCATTGTTGCTCCTGATGCCTTTGACATCATTGACCTGTCAGCAGGAGGCCAGCTTACCACAGACCAACGCCGAAATCTGGGCTCCATTGCAAAAATGCTTCAGCATGCTGCTTCCAATAAGATGTTTCTGGGAGATAATGCCCACTTAAGCATCATTAATGAATATCTTTCCCAGTCCTACCAGAAATTCAGACGGTTTTTCCAAACTGCTTGTGATGTCCCAGAGCTTCAGGATAAATTTAATGTGGATGAGTACTCTGATTTAGTAACCCTCACCAAACCAGTAATCTACATTTCCATTGGTGAAATCATCAACACCCACACTCTCCTGTTGGATCACCAGGATGCCATTGCTCCG GAGCACAATGATCCAATCCACGAACTGCTGGACGACCTCGGCGAGGTGCCCACCATCGAGTCCCTGATAGGGGAAAGCTCTGGCAATTTAAATGACCCAAATAAGGAGGCACTGGCTAAGACGGAAGTGTCTCTCACCCTGACCAACAAGTTCGACGTGCCTGGAGATGAGAATGCAGAAATGGATGCTCGAACCATCTTACTGAATACAAAACGTTTAATTGTGGATGTCATCCGGTTCCAGCCAGGAGAGACCTTGACTGAAATCCTAGAAACACCAGCCACCAGTGAACAGGAAGCAGAACATCAGAGAGCCATGCAGAGACGTGCTATCCGTGATGCCAAAACACCTGACAAGATGAAAAAGTCAAAATCTGTAAAGGAAGACAGCAACCTCACTCTTCAAGAGAAGAAAGAGAAGATCCAGACAGGTTTAAAGAAGCTAACAGAGCTTGGAACCGTGGACCCAAAGAACAAATACCAGGAACTGATCAACGACATTGCCAGGGATATTCGGAATCAGCGGAGGTACCGACAGAGGAGAAAGGCCGAACTAGTGAAACTGCAACAGACATACGCTGCTCTGAACTCTAAGGCCACCTTTTATGGGGAGCAGGTGGATTACTATAAAAGCTATATCAAAACCTGCTTGGATAACTTAGCCAGCAAGGGCAAAGTCTCCAAAAAGCCTAGGGAAATGAAAGGAAAGAAAAGCAAAAAGATTTCTCTGAAATATACAGCAGCAAGACTACATGAAAAAGGAGTTCTTCTGGAAATTGAGGACCTGCAAGTGAATCAGTTTAAAAATGTTATATTTGAAATCAGTCCAACAGAAGAAGTTGGAGACTTCGAAGTGAAAGCCAAATTCATGGGAGTTCAAATGGAGACTTTTATGTTACATTATCAGGACCTGCTGCAGCTACAGTATGAAGGAGTTGCAGTCATGAAATTATTTGATAGAGCTAAAGTAAATGTCAACCTCCTGATCTTCCTTCTCAACAAAAAGTTCTACGGGAAGTAATTGATCGTTTGCTGCCAGCCCAGAAGGATGAAGGAAAGAAGCACCTCACAGCTCCTTTCTAGGTCCTTCTTTCCTCATTGGAAGCAAAGACCTAGCCAACAACAGCACCTCAATCTGATACACTCCCGATGCCACATTTTTAACTCCTCTCGCTCTGATGGGACATTTGTTACCCTTTTTTCATAGTGAAATTGTGTTTCAGGCTTAGTCTGACCTTTCTGGTTTCTTCATTTTCTTCCATTACTTAGGAAAGAGTGGAAACTCCACTAAAATTTCTCTGTGTTGTTACAGTCTTAGAGGTTGCAGTACTATATTGTAAGCTTTGGTGTTTGTTTAATTAGCAATAGGGATGGTAGGATTCAAATGTGTGTCATTTAGAAGTGGAAGCTATTAGCACCAATGACATAAATACATACAAGACACACAACTAAAATGTCATGTTATTAACAGTTATTAGGTTGTCATTTAAAAATAAAGTTCCTTTATATTTCTGTCCCATCAGGAAAACTGAAGGATATGGGGAATCATTGGTTATCTTCCATTGTGTTTTTCTTTATGGACAGGAGCTAATGGAAGTGACAGTCATGTTCAAAGGAAGCATTTCTAGAAAAAAGGAGATAATGTTTTTAAATTTCATTATCAAACTTGGGCAATTCTGTTTGTGTAACTCCCCGACTAGTGGATGGGAGAGTCCCATTGCTAAAATTCAGCTACTCAGATAAATTCAGAATGGGTCAAGGCACCTGCGAAGAGCGAAATTAAGAAGGGCGAATTCTGCAGATATCCATCACACTGGCGGCCGCTCGAGCATGCATCTAGAGGGCCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTATACGTACGGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATGTACAGAGTGATATTATTGACACGCCGGGGCGACGGATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCTCCCGTGAACTTTACCCGGTGGTGCATATCGGGGATGAAAGCTGGCGCATGATGACCACCGATATGGCCAGTGTGCCGGTCTCCGTTATCGGGGAAGAAGTGGCTGATCTCAGCCACCGCGAAAATGACATCAAAAACGCCATTAACCTGATGTTCTGGGGAATATAAATGTCAGGCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTCACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGGATGAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGCAGGTAGCTTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTCGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGCTCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAAGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGAGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAATTATTAACGCTTACAATTTCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATACAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATAGCACGTGAGGAGGGCCACCATGGCCAAGTTGACCAGTGCCGTTCCGGTGCTCACCGCGCGCGACGTCGCCGGAGCGGTCGAGTTCTGGACCGACCGGCTCGGGTTCTCCCGGGACTTCGTGGAGGACGACTTCGCCGGTGTGGTCCGGGACGACGTGACCCTGTTCATCAGCGCGGTCCAGGACCAGGTGGTGCCGGACAACACCCTGGCCTGGGTGTGGGTGCGCGGCCTGGACGAGCTGTACGCCGAGTGGTCGGAGGTCGTGTCCACGAACTTCCGGGACGCCTCCGGGCCGGCCATGACCGAGATCGGCGAGCAGCCGTGGGGGCGGGAGTTCGCCCTGCGCGACCCGGCCGGCAACTGCGTGCACTTCGTGGCCGAGGAGCAGGACTGACACGTGCTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAA

Sequencing Information:

Phred Score: 918
Date: 2018-11-26

Last Passing Sequencing Read:

NNNNNCCCACTACATGCATAGCTTGGTACCGAGCTCGGATCCACTAGTAA CGGCCGCCAGTGTGCTGGAATTCGCCCTTCGCTCTTCGCAGGTGCCTTGA CCCATTCTGAATTTATCTGAGTAGCTGAATTTTAGCAATGGGACTCTCCC ATCCACTAGTCGGGGAGTTACACAAACAGAATTGCCCAAGTTTGATAATG AAATTTAAAAACATTATCTCCTTTTTTCTAGAAATGCTTCCTTTGAACAT GACTGTCACTTCCATTAGCTCCTGTCCATAAAGAAAAACACAATGGAAGA TAACCAATGATTCCCCATATCCTTCAGTTTTCCTGATGGGACAGAAATAT AAAGGAACTTTATTTTTAAATGACAACCTAATAACTGTTAATAACATGAC ATTTTAGTTGTGTGTCTTGTATGTATTTATGTCATTGGTGCTAATAGCTT CCACTTCTAAATGACACACATTTGAATCCTACCATCCCTATTGCTAATTA AACAAACACCAAAGCTTACAATATAGTACTGCAACCTCTAAGACTGTAAC AACACAGAGAAATTTTAGTGGAGTTTCCACTCTTTCCTAAGTAATGGAAG AAAATGAAGAAACCAGAAAGGTCAGACTAAGCCTGAAACACAATTTCACT ATGAAAAAAGGGTAACAAATGTCCCATCAGAGCGAGAGGAGTTAAAAATG TGGCATCGGGAGTGTATCAGATTGAGGTGCTGTTGTTGGCTAGGTCTTTG CTTCCAATGAGGAAAGAAGGACCTAGAAAGGAGCTGTGAGGTGCTTCTTT CCTTCATCCTTCTGGGCTGGCAGCAAACGATCAATTACTTCCCGTAGAAC TTTTTGTTGAGAAGGAAGATCAGGAGGTTGACATTTACTTTAGCTCTATC AAATAATTTCATGACTGCAACTCCTTCATACTGTAGCTGCAGCAGGTCCT GATAATGTAACATAAAAGTCTCCATTTGAACTCCCATGAATTTNGCCTTT CACTCGAAGTCTCCNACTTCGTCTGNTGGACTGATTNCAAATATAACATT TTTAAACTGATTCACTTGCANGTTCTCAATTTCCAGAGGAACTCCTTTTT CATGGANCTTGCCGCTGNAAAATTCAGAGAAACTTTTTGCTTTCCTTTCC TTCATTCCCCAGGCTTTTGGAAACTTGGCCCTGCTGGCTAATTATTCAAC AGTTTTGAAAAGCTTTAAAAAATCCACTGCTCCCCAAAAGGGGCCTAAAT TCCAAAAGCGATGCTGTGCAATTCAAATTCGGCTTTCCCCGGCGGACCTC CCGTATCAAAACCCGGAAAGGCTAAAAACCCGGTATTTCTTTGGCCCGGT CCAACTGTAATTTTAACGGCGAATTCTTTTTCTAAAGGATGGTTCCTTTA

Vector Information:

Vector Name:pCR-BluntII-TOPO
Type:bacterial plasmid
Description:TOPO Cloning vector for bacterial expression; kanamycin resistance in bacteria
Properties:bacterial expression
Comments:PCR cloning vector, cloning site between the EcoRI sites (capitalized) as follows: GAATTCgccctt--cDNA INSERT--agggcGAATTC. The vector contains the ccdB gene fused to the C-terminus of the LacZa fragment. Ligation of a blunt-end PCR product disrupts expression of the lacZa-ccdB gene fusion permitting growth of only positive recombinants upon transformation. Cells that contain non-recombinant vector are killed upon plating. Therefore, blue/white screening is not required.
Map:pCRBluntIITopo.bmp
Sequence:pCR_BluntII_TOPO.txt
Size (bp):3519
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha N

Antibiotic Selections:

Host Type Marker
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 50ug/mL kanamycin Growth with the single antibiotic in LB at 37 degrees is recommended. Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.

Authors:

Author Name Author Type
MGC Consortium