Clone: HsCD00346386

Clone ID:HsCD00346386
Is Verified:Y
Status:AVAILABLE
Source:MGC
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

IMAGE ID 40008964
GI 109730102
GenBank Accession BC096346
Original Clone ID MGC:117042

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 3645 Homo sapiens CLOSED 3684 ITGAM integrin, alpha M (complement component 3 receptor 3 subunit)
Insert1
Size (bp)3645
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 3684
Gene SymbolITGAM
Gene Nameintegrin, alpha M (complement component 3 receptor 3 subunit)
Keyword

Insert Sequence:

TGGTTCCTCAGTGGTGCCTGCAACCCCTGGTTCACCTCCTTCCAGGTTCTGGCTCCTTCCAGCCATGGCTCTCAGAGTCCTTCTGTTAACAGCCTTGACCTTATGTCATGGGTTCAACTTGGACACTGAAAACGCAATGACCTTCCAAGAGAACGCAAGGGGCTTCGGGCAGAGCGTGGTCCAGCTTCAGGGATCCAGGGTGGTGGTTGGAGCCCCCCAGGAGATAGTGGCTGCCAACCAAAGGGGCAGCCTCTACCAGTGCGACTACAGCACAGGCTCATGCGAGCCCATCCGCCTGCAGGTCCCCGTGGAGGCCGTGAACATGTCCCTGGGCCTGTCCCTGGCAGCCACCACCAGCCCCCCTCAGCTGCTGGCCTGTGGTCCCACCGTGCACCAGACTTGCAGTGAGAACACGTATGTGAAAGGGCTCTGCTTCCTGTTTGGATCCAACCTACGGCAGCAGCCCCAGAAGTTCCCAGAGGCCCTCCGAGGGTGTCCTCAAGAGGATAGTGACATTGCCTTCTTGATTGATGGCTCTGGTAGCATCATCCCACATGACTTTCGGCGGATGAAGGAGTTTGTCTCAACTGTGATGGAGCAATTAAAAAAGTCCAAAACCTTGTTCTCTTTGATGCAGTACTCTGAAGAATTCCGGATTCACTTTACCTTCAAAGAGTTCCAGAACAACCCTAACCCAAGATCACTGGTGAAGCCAATAACGCAGCTGCTTGGGCGGACACACACGGCCACGGGCATCCGCAAAGTGGTACGAGAGCTGTTTAACATCACCAACGGAGCCCGAAAGAATGCCTTTAAGATCCTAGTTGTCATCACGGATGGAGAAAAGTTTGGCGATCCCTTGGGATATGAGGATGTCATCCCTGAGGCAGACAGAGAGGGAGTCATTCGCTACGTCATTGGGGTGGGAGATGCCTTCCGCAGTGAGAAATCCCGCCAAGAGCTTAATACCATCGCATCCAAGCCGCCTCGTGATCACGTGTTCCAGGTGAATAACTTTGAGGCTCTGAAGACCATTCAGAACCAGCTTCGGGAGAAGATCTTTGCGATCGAGGGTACTCAGACAGGAAGTAGCAGCTCCTTTGAGCATGAGATGTCTCAGGAAGGCTTCAGCGCTGCCATCACCTCTAATGGCCCCTTGCTGAGCACTGTGGGGAGCTATGACTGGGCTGGTGGAGTCTTTCTATATACATCAAAGGAGAAAAGCACCTTCATCAACATGACCAGAGTGGATTCAGACATGAATGATGCTTACTTGGGTTATGCTGCCGCCATCATCTTACGGAACCGGGTGCAAAGCCTGGTTCTGGGGGCACCTCGATATCAGCACATCGGCCTGGTAGCGATGTTCAGGCAGAACACTGGCACGTGGGAGTCCAACGCTAATGTCAAGGGCACCCAGATCGGCGCCTACTTCGGGGCCTCCCTCTGCTCCGTGGACGTGGACAGCAACGGCAGCACCGACCTGGTCCTCATCGGGGCCCCCCATTACTACGAGCAGACCCGAGGGGGCCAGGTGTCCGTGTGCCCCTTGCCCAGGGGGAGGGCTCGGTGGCAGTGTGATGCTGTTCTCTACGGGGAGCAGGGCCAACCCTGGGGCCGCTTTGGGGCAGCCCTAACAGTGCTGGGGGACGTAAATGGGGACAAGCTGACGGACGTGGCCATTGGGGCCCCAGGAGAGGAGGACAACCGGGGTGCTGTTTACCTGTTTCACGGAACCTCAGGATCTGGCATCAGCCCCTCCCATAGCCAGCGGATAGCAGGCTCCAAGCTCTCTCCCAGGCTCCAGTATTTTGGTCAGTCACTGAGTGGGGGCCAGGACCTCACAATGGATGGACTGGTAGACCTGACTGTAGGAGCCCAGGGGCACGTGCTGCTGCTCAGGTCCCAGCCAGTACTGAGAGTCAAGGCAATCATGGAGTTCAATCCCAGGGAAGTGGCAAGGAATGTATTTGAGTGTAATGATCAGGTGGTGAAAGGCAAGGAAGCCGGAGAGGTCAGAGTCTGCCTCCATGTCCAGAAGAGCACACGGGATCGGCTAAGAGAAGGACAGATCCAGAGTGTTGTGACTTATGACCTGGCTCTGGACTCCGGCCGCCCACATTCCCGCGCCGTCTTCAATGAGACAAAGAACAGCACACGCAGACAGACACAGGTCTTGGGGCTGACCCAGACTTGTGAGACCCTGAAACTACAGTTGCCGAATTGCATCGAGGACCCAGTGAGCCCCATTGTGCTGCGCCTGAACTTCTCTCTGGTGGGAACGCCATTGTCTGCTTTCGGGAACCTCCGGCCAGTGCTGGCGGAGGATGCTCAGAGACTCTTCACAGCCTTGTTTCCCTTTGAGAAGAATTGTGGCAATGACAACATCTGCCAGGATGACCTCAGCATCACCTTCAGTTTCATGAGCCTGGACTGCCTCGTGGTGGGTGGGCCCCGGGAGTTCAACGTGACAGTGACTGTGAGAAATGATGGTGAGGACTCCTACAGGACACAGGTCACCTTCTTCTTCCCGCTTGACCTGTCCTACCGGAAGGTGTCCACGCTCCAGAACCAGCGCTCACAGCGATCCTGGCGCCTGGCCTGTGAGTCTGCCTCCTCCACCGAAGTGTCTGGGGCCTTGAAGAGCACCAGCTGCAGCATAAACCACCCCATCTTCCCGGAAAACTCAGAGGTCACCTTTAATATCACGTTTGATGTAGACTCTAAGGCTTCCCTTGGAAACAAACTGCTCCTCAAGGCCAATGTGACCAGTGAGAACAACATGCCCAGAACCAACAAAACCGAATTCCAACTGGAGCTGCCGGTGAAATATGCTGTCTACATGGTGGTCACCAGCCATGGGGTCTCCACTAAATATCTCAACTTCACGGCCTCAGAGAATACCAGTCGGGTCATGCAGCATCAATATCAGGTCAGCAACCTGGGGCAGAGGAGCCTCCCCATCAGCCTGGTGTTCTTGGTGCCCGTCCGGCTGAACCAGACTGTCATATGGGACCGCCCCCAGGTCACCTTCTCCGAGAACCTCTCGAGTACGTGCCACACCAAGGAGCGCTTGCCCTCTCACTCCGACTTTCTGGCTGAGCTTCGGAAGGCCCCCGTGGTGAACTGCTCCATCGCTGTCTGCCAGAGAATCCAGTGTGACATCCCGTTCTTTGGCATCCAGGAAGAATTCAATGCTACCCTCAAAGGCAACCTCTCGTTTGACTGGTACATCAAGACCTCGCATAACCACCTCCTGATCGTGAGCACAGCTGAGATCTTGTTTAACGATTCCGTGTTCACCCTGCTGCCGGGACAGGGGGCGTTTGTGAGGTCCCAGACGGAGACCAAAGTGGAGCCGTTCGAGGTCCCCAACCCCCTGCCGCTCATCGTGGGCAGCTCTGTCGGGGGACTGCTGCTCCTGGCCCTCATCACCGCCGCGCTGTACAAGCTCGGCTTCTTTAAGCGGCAATACAAGGACATGATGAGTGAAGGGGGTCCCCCGGGGGCCGAACCCCAGTAGCGGCTCCTTCCCGACAGAGCTGCCTCTCGGTGGCCAGCAGGACTCTGCCCAGACCACACGTAGCCCCCAGGCTGCTGGACACGTCGGACAGCGAAGTATCCCCGACAGGACGGGCTTGGGCT

Insert Property: Insert 1

Type Value Extra Information
CDS Start 65
CDS Stop 3523

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

AGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGGCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTATTTAGGTGACACTATAGAATACTCAAGCTATGCATCAAGCTTGGTACCGAGCTCGGATCCACTAGTAACGGCCGCCAGTGTGCTGGAATTCGCCCTTTGGTTCCTCAGTGGTGCCTGCAACCCCTGGTTCACCTCCTTCCAGGTTCTGGCTCCTTCCAGCCATGGCTCTCAGAGTCCTTCTGTTAACAGCCTTGACCTTATGTCATGGGTTCAACTTGGACACTGAAAACGCAATGACCTTCCAAGAGAACGCAAGGGGCTTCGGGCAGAGCGTGGTCCAGCTTCAGGGATCCAGGGTGGTGGTTGGAGCCCCCCAGGAGATAGTGGCTGCCAACCAAAGGGGCAGCCTCTACCAGTGCGACTACAGCACAGGCTCATGCGAGCCCATCCGCCTGCAGGTCCCCGTGGAGGCCGTGAACATGTCCCTGGGCCTGTCCCTGGCAGCCACCACCAGCCCCCCTCAGCTGCTGGCCTGTGGTCCCACCGTGCACCAGACTTGCAGTGAGAACACGTATGTGAAAGGGCTCTGCTTCCTGTTTGGATCCAACCTACGGCAGCAGCCCCAGAAGTTCCCAGAGGCCCTCCGAGGGTGTCCTCAAGAGGATAGTGACATTGCCTTCTTGATTGATGGCTCTGGTAGCATCATCCCACATGACTTTCGGCGGATGAAGGAGTTTGTCTCAACTGTGATGGAGCAATTAAAAAAGTCCAAAACCTTGTTCTCTTTGATGCAGTACTCTGAAGAATTCCGGATTCACTTTACCTTCAAAGAGTTCCAGAACAACCCTAACCCAAGATCACTGGTGAAGCCAATAACGCAGCTGCTTGGGCGGACACACACGGCCACGGGCATCCGCAAAGTGGTACGAGAGCTGTTTAACATCACCAACGGAGCCCGAAAGAATGCCTTTAAGATCCTAGTTGTCATCACGGATGGAGAAAAGTTTGGCGATCCCTTGGGATATGAGGATGTCATCCCTGAGGCAGACAGAGAGGGAGTCATTCGCTACGTCATTGGGGTGGGAGATGCCTTCCGCAGTGAGAAATCCCGCCAAGAGCTTAATACCATCGCATCCAAGCCGCCTCGTGATCACGTGTTCCAGGTGAATAACTTTGAGGCTCTGAAGACCATTCAGAACCAGCTTCGGGAGAAGATCTTTGCGATCGAGGGTACTCAGACAGGAAGTAGCAGCTCCTTTGAGCATGAGATGTCTCAGGAAGGCTTCAGCGCTGCCATCACCTCTAATGGCCCCTTGCTGAGCACTGTGGGGAGCTATGACTGGGCTGGTGGAGTCTTTCTATATACATCAAAGGAGAAAAGCACCTTCATCAACATGACCAGAGTGGATTCAGACATGAATGATGCTTACTTGGGTTATGCTGCCGCCATCATCTTACGGAACCGGGTGCAAAGCCTGGTTCTGGGGGCACCTCGATATCAGCACATCGGCCTGGTAGCGATGTTCAGGCAGAACACTGGCACGTGGGAGTCCAACGCTAATGTCAAGGGCACCCAGATCGGCGCCTACTTCGGGGCCTCCCTCTGCTCCGTGGACGTGGACAGCAACGGCAGCACCGACCTGGTCCTCATCGGGGCCCCCCATTACTACGAGCAGACCCGAGGGGGCCAGGTGTCCGTGTGCCCCTTGCCCAGGGGGAGGGCTCGGTGGCAGTGTGATGCTGTTCTCTACGGGGAGCAGGGCCAACCCTGGGGCCGCTTTGGGGCAGCCCTAACAGTGCTGGGGGACGTAAATGGGGACAAGCTGACGGACGTGGCCATTGGGGCCCCAGGAGAGGAGGACAACCGGGGTGCTGTTTACCTGTTTCACGGAACCTCAGGATCTGGCATCAGCCCCTCCCATAGCCAGCGGATAGCAGGCTCCAAGCTCTCTCCCAGGCTCCAGTATTTTGGTCAGTCACTGAGTGGGGGCCAGGACCTCACAATGGATGGACTGGTAGACCTGACTGTAGGAGCCCAGGGGCACGTGCTGCTGCTCAGGTCCCAGCCAGTACTGAGAGTCAAGGCAATCATGGAGTTCAATCCCAGGGAAGTGGCAAGGAATGTATTTGAGTGTAATGATCAGGTGGTGAAAGGCAAGGAAGCCGGAGAGGTCAGAGTCTGCCTCCATGTCCAGAAGAGCACACGGGATCGGCTAAGAGAAGGACAGATCCAGAGTGTTGTGACTTATGACCTGGCTCTGGACTCCGGCCGCCCACATTCCCGCGCCGTCTTCAATGAGACAAAGAACAGCACACGCAGACAGACACAGGTCTTGGGGCTGACCCAGACTTGTGAGACCCTGAAACTACAGTTGCCGAATTGCATCGAGGACCCAGTGAGCCCCATTGTGCTGCGCCTGAACTTCTCTCTGGTGGGAACGCCATTGTCTGCTTTCGGGAACCTCCGGCCAGTGCTGGCGGAGGATGCTCAGAGACTCTTCACAGCCTTGTTTCCCTTTGAGAAGAATTGTGGCAATGACAACATCTGCCAGGATGACCTCAGCATCACCTTCAGTTTCATGAGCCTGGACTGCCTCGTGGTGGGTGGGCCCCGGGAGTTCAACGTGACAGTGACTGTGAGAAATGATGGTGAGGACTCCTACAGGACACAGGTCACCTTCTTCTTCCCGCTTGACCTGTCCTACCGGAAGGTGTCCACGCTCCAGAACCAGCGCTCACAGCGATCCTGGCGCCTGGCCTGTGAGTCTGCCTCCTCCACCGAAGTGTCTGGGGCCTTGAAGAGCACCAGCTGCAGCATAAACCACCCCATCTTCCCGGAAAACTCAGAGGTCACCTTTAATATCACGTTTGATGTAGACTCTAAGGCTTCCCTTGGAAACAAACTGCTCCTCAAGGCCAATGTGACCAGTGAGAACAACATGCCCAGAACCAACAAAACCGAATTCCAACTGGAGCTGCCGGTGAAATATGCTGTCTACATGGTGGTCACCAGCCATGGGGTCTCCACTAAATATCTCAACTTCACGGCCTCAGAGAATACCAGTCGGGTCATGCAGCATCAATATCAGGTCAGCAACCTGGGGCAGAGGAGCCTCCCCATCAGCCTGGTGTTCTTGGTGCCCGTCCGGCTGAACCAGACTGTCATATGGGACCGCCCCCAGGTCACCTTCTCCGAGAACCTCTCGAGTACGTGCCACACCAAGGAGCGCTTGCCCTCTCACTCCGACTTTCTGGCTGAGCTTCGGAAGGCCCCCGTGGTGAACTGCTCCATCGCTGTCTGCCAGAGAATCCAGTGTGACATCCCGTTCTTTGGCATCCAGGAAGAATTCAATGCTACCCTCAAAGGCAACCTCTCGTTTGACTGGTACATCAAGACCTCGCATAACCACCTCCTGATCGTGAGCACAGCTGAGATCTTGTTTAACGATTCCGTGTTCACCCTGCTGCCGGGACAGGGGGCGTTTGTGAGGTCCCAGACGGAGACCAAAGTGGAGCCGTTCGAGGTCCCCAACCCCCTGCCGCTCATCGTGGGCAGCTCTGTCGGGGGACTGCTGCTCCTGGCCCTCATCACCGCCGCGCTGTACAAGCTCGGCTTCTTTAAGCGGCAATACAAGGACATGATGAGTGAAGGGGGTCCCCCGGGGGCCGAACCCCAGTAGCGGCTCCTTCCCGACAGAGCTGCCTCTCGGTGGCCAGCAGGACTCTGCCCAGACCACACGTAGCCCCCAGGCTGCTGGACACGTCGGACAGCGAAGTATCCCCGACAGGACGGGCTTGGGCTAAATTAAGAAGGGCGAATTCTGCAGATATCCATCACACTGGCGGCCGCTCGAGCATGCATCTAGAGGGCCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTATACGTACGGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATGTACAGAGTGATATTATTGACACGCCGGGGCGACGGATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCTCCCGTGAACTTTACCCGGTGGTGCATATCGGGGATGAAAGCTGGCGCATGATGACCACCGATATGGCCAGTGTGCCGGTCTCCGTTATCGGGGAAGAAGTGGCTGATCTCAGCCACCGCGAAAATGACATCAAAAACGCCATTAACCTGATGTTCTGGGGAATATAAATGTCAGGCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTCACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGGATGAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGCAGGTAGCTTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTCGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGCTCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAAGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGAGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAATTATTAACGCTTACAATTTCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATACAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATAGCACGTGAGGAGGGCCACCATGGCCAAGTTGACCAGTGCCGTTCCGGTGCTCACCGCGCGCGACGTCGCCGGAGCGGTCGAGTTCTGGACCGACCGGCTCGGGTTCTCCCGGGACTTCGTGGAGGACGACTTCGCCGGTGTGGTCCGGGACGACGTGACCCTGTTCATCAGCGCGGTCCAGGACCAGGTGGTGCCGGACAACACCCTGGCCTGGGTGTGGGTGCGCGGCCTGGACGAGCTGTACGCCGAGTGGTCGGAGGTCGTGTCCACGAACTTCCGGGACGCCTCCGGGCCGGCCATGACCGAGATCGGCGAGCAGCCGTGGGGGCGGGAGTTCGCCCTGCGCGACCCGGCCGGCAACTGCGTGCACTTCGTGGCCGAGGAGCAGGACTGACACGTGCTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAA

Sequencing Information:

Phred Score: 903
Date: 2019-04-12

Last Passing Sequencing Read:

NNCCAACNNNNNNNNGGCAGCTGCATAGCTTGGTCCGAGCTCGGATCCCTAGTAACGGCCGCCAGTGTGCTGGAATTCGCCCTTGACCTCTCAGCCCAAGCCCGTCCTGTCGGGGATACTTCGCTGTCCGACGTGTCCAGCAGCCTGGGGGCTACGTGTGGTCTGGGCAGAGTCCTGCTGGCCACCGAGAGGCAGCTCTGTCGGGAAGGAGCCGCTACTGGGGTTCGGCCCCCGGGGGACCCCCTTCACTCATCATGTCCTTGTATTGCCGCTTAAAGAAGCCGAGCTTGTACAGCGCGGCGGTGATGAGGGCCAGGAGCAGCAGTCCCCCGACAGAGCTGCCCACGATGAGCGGCAGGGGGTTGGGGACCTCGAACGGCTCCACTTTGGTCTCCGTCTGGGACCTCACAAACGCCCCCTGTCCCGGCAGCAGGGTGAACACGGAATCGTTAAACAAGATCTCAGCTGTGCTCACGATCAGGAGGTGGTTATGCGAGGTCTTGATGTACCAGTCAAACGAGAGGTTGCCTTTGAGGGTAGCATTGAATTCTTCCTGGATGCCAAAGAACGGGATGTCACACTGGATTCTCTGGCAGACAGCGATGGAGCAGTTCACCACGGGGGCCTTCCGAAGCTCAGCCAGAAAGTCGGAGTGAGAGGGCAAGCGCTCCTTGGTGTGGCACGTACTCGAGAGGTTCTCGGAGAAGGTGACCTGGGGGCGGTCCCATATGACAGTCTGGTTCAGCCGGACGGGCACCAAGAACACCAGGCTGATGGGGAGGCTCCTCTGCCCCAGGTTGCTGACCTGATATTGATGCTGCATGACCCGACTGGTATTCTCTGAGGCCGTGAAGTTGAGATATTTAGTGGAGACCCCATGGCTGGTGACCACCATGTAGACAGCATATTTCACCGGCAGCTCCAGTTGGAATTCGGTTTTGTTGGTTCTGGGCATGTTGTTCTCACTGGTCACATTGGCCTTGAGGAGCAGTTTGTTTCCAGGGGAGCCTTAGAGTCTACATCAAACGTGATATAAAAAGTGACCTCTGAGTTTTCGGGNAGATGGGGTGTTTATGCTGCAACTGTGCTCTTCAAGCCCCAGAACCTTCGGTGAAGGAAGCAGACTCCCAGGCAGGCGCCCAGATCCCTGTGAACCCTGTTTCTGAACTTGGACCCTTTCGGGTAGACCAGTCAACGGGAAAAAAAAGGGACCTGGGTCTGAAGGAATCTCCCCTTCATTTCCAAATTCC

Vector Information:

Vector Name:pCR-BluntII-TOPO
Type:bacterial plasmid
Description:TOPO Cloning vector for bacterial expression; kanamycin resistance in bacteria
Properties:bacterial expression
Comments:PCR cloning vector, cloning site between the EcoRI sites (capitalized) as follows: GAATTCgccctt--cDNA INSERT--agggcGAATTC. The vector contains the ccdB gene fused to the C-terminus of the LacZa fragment. Ligation of a blunt-end PCR product disrupts expression of the lacZa-ccdB gene fusion permitting growth of only positive recombinants upon transformation. Cells that contain non-recombinant vector are killed upon plating. Therefore, blue/white screening is not required.
Map:pCRBluntIITopo.bmp
Sequence:pCR_BluntII_TOPO.txt
Size (bp):3519
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha N

Antibiotic Selections:

Host Type Marker
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 50ug/mL kanamycin Growth with the single antibiotic in LB at 37 degrees is recommended. Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.

Authors:

Author Name Author Type
MGC Consortium