Clone: HsCD00346347

Clone ID:HsCD00346347
Is Verified:Y
Status:AVAILABLE
Source:MGC
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

IMAGE ID 40008290
GI 64653334
GenBank Accession BC096331
Original Clone ID MGC:117015

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 2343 Homo sapiens CLOSED 5378 PMS1 PMS1 postmeiotic segregation increased 1 (S. cerevisiae)
Insert1
Size (bp)2343
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 5378
Gene SymbolPMS1
Gene NamePMS1 postmeiotic segregation increased 1 (S. cerevisiae)
Keyword

Insert Sequence:

GCTGCTTGCGGCTAGTGGATGGTAATTGCCTGCCTCGCGCTAGCAGGAAGCTGCTCTGTTAAAGCGAAAATGAAACAATTGCCTGCGGCAACAGTTCGACTCCTTTCAAGTTCTCAGATCATCACTTCGGTGGTCAGTGTTGTAAAAGAGCTTATTGAAAACTCCTTGGATGCTGGTGCCACAAGCGTAGATGTTAAACTGGAGAACTATGGATTTGATAAAATTGAGGTGCGAGATAACGGGGAGGGTATCAAGGCTGTTGATGCACCTGTAATGGCAATGAAGTACTACACCTCAAAAATAAATAGTCATGAAGATCTTGAAAATTTGACAACTTACGGTTTTCGTGGAGAAGCCTTGGGGTCAATTTGTTGTATAGCTGAGGTTTTAATTACAACAAGAACGGCTGCTGATAATTTTAGCACCCAGTATGTTTTAGATGGCAGTGGCCACATACTTTCTCAGAAACCTTCACATCTTGGTCAAGGTACAACTGTAACTGCTTTAAGATTATTTAAGAATCTACCTGTAAGAAAGCAGTTTTACTCAACTGCAAAAAAATGTAAAGATGAAATAAAAAAGATCCAAGATCTCCTCATGAGCTTTGGTATCCTTAAACCTGACTTAAGGATTGTCTTTGTACATAACAAGGCAGTTATTTGGCAGAAAAGCAGAGTATCAGATCACAAGATGGCTCTCATGTCAGTTCTGGGGACTGCTGTTATGAACAATATGGAATCCTTTCAGTACCACTCTGAAGAATCTCAGATTTATCTCAGTGGATTTCTTCCAAAGTGTGATGCAGACCACTCTTTCACTAGTCTTTCAACACCAGAAAGAAGTTTCATCTTCATAAACAGTCGACCAGTACATCAAAAAGATATCTTAAAGTTAATCCGACATCATTACAATCTGAAATGCCTAAAGGAATCTACTCGTTTGTATCCTGTTTTCTTTCTGAAAATCGATGTTCCTACAGCTGATGTTGATGTAAATTTAACACCAGATAAAAGCCAAGTATTATTACAAAATAAGGAATCTGTTTTAATTGCTCTTGAAAATCTGATGACGACTTGTTATGGACCATTACCTAGTACAAATTCTTATGAAAATAATAAAACAGATGTTTCCGCAGCTGACATCGTTCTTAGTAAAACAGCAGAAACAGATGTGCTTTTTAATAAAGTGGAATCATCTGGAAAGAATTATTCAAATGTTGATACTTCAGTCATTCCATTCCAAAATGATATGCATAATGATGAATCTGGAAAAAACACTGATGATTGTTTAAATCACCAGATAAGTATTGGTGACTTTGGTTATGGTCATTGTAGTAGTGAAATTTCTAACATTGATAAAAACACTAAGAATGCATTTCAGGACATTTCAATGAGTAATGTATCATGGGAGAACTCTCAGACGGAATATAGTAAAACTTGTTTTATAAGTTCCGTTAAGCACACCCAGTCAGAAAATGGCAATAAAGACCATATAGATGAGAGTGGGGAAAATGAGGAAGAAGCAGGTCTTGAAAACTCTTCGGAAATTTCTGCAGATGAGTGGAGCAGGGGAAATATACTTAAAAATTCAGTGGGAGAGAATATTGAACCTGTGAAAATTTTAGTGCCTGAAAAAAGTTTACCATGTAAAGTAAGTAATAATAATTATCCAATCCCTGAACAAATGAATCTTAATGAAGATTCATGTAACAAAAAATCAAATGTAATAGATAATAAATCTGGAAAAGTTACAGCTTATGATTTACTTAGCAATCGAGTAATCAAGAAACCCATGTCAGCAAGTGCTCTTTTTGTTCAAGATCATCGTCCTCAGTTTCTCATAGAAAATCCTAAGACTAGTTTAGAGGATGCAACACTACAAATTGAAGAACTGTGGAAGACATTGAGTGAAGAGGAAAAACTGAATCTTTTTAATGGATCTCATTATTTAGACGTTTTATATAAAATGACAGCAGATGACCAAAGATACAGTGGATCAACTTACCTGTCTGATCCTCGTCTTACAGCGAATGGTTTCAAGATAAAATTGATACCAGGAGTTTCAATTACTGAAAATTAATTGGAAATAGAAGGAATGGCTAATTGTCTCCCATTCTATGGAGTAGCAGATTTAAAAGAAATTCTTAATGCTATATTAAACAGAAATGCAAAGGAAGTTTATGAATGTAGACCTCGCAAAGTGATAAGTTATTTAGAGGGAGAAGCAGTGCGTCTATCCAGACAATTACCCATGTACTTATCAAAAGAGGACATCCAAGACATTATCTACAGAATGAAGCACCAGTTTGGAAATGAAATTAAAGAGTGTGTTCATGGTCGCCCA

Insert Property: Insert 1

Type Value Extra Information
CDS Start 70
CDS Stop 2079

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

AGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGGCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTATTTAGGTGACACTATAGAATACTCAAGCTATGCATCAAGCTTGGTACCGAGCTCGGATCCACTAGTAACGGCCGCCAGTGTGCTGGAATTCGCCCTTGCTGCTTGCGGCTAGTGGATGGTAATTGCCTGCCTCGCGCTAGCAGGAAGCTGCTCTGTTAAAGCGAAAATGAAACAATTGCCTGCGGCAACAGTTCGACTCCTTTCAAGTTCTCAGATCATCACTTCGGTGGTCAGTGTTGTAAAAGAGCTTATTGAAAACTCCTTGGATGCTGGTGCCACAAGCGTAGATGTTAAACTGGAGAACTATGGATTTGATAAAATTGAGGTGCGAGATAACGGGGAGGGTATCAAGGCTGTTGATGCACCTGTAATGGCAATGAAGTACTACACCTCAAAAATAAATAGTCATGAAGATCTTGAAAATTTGACAACTTACGGTTTTCGTGGAGAAGCCTTGGGGTCAATTTGTTGTATAGCTGAGGTTTTAATTACAACAAGAACGGCTGCTGATAATTTTAGCACCCAGTATGTTTTAGATGGCAGTGGCCACATACTTTCTCAGAAACCTTCACATCTTGGTCAAGGTACAACTGTAACTGCTTTAAGATTATTTAAGAATCTACCTGTAAGAAAGCAGTTTTACTCAACTGCAAAAAAATGTAAAGATGAAATAAAAAAGATCCAAGATCTCCTCATGAGCTTTGGTATCCTTAAACCTGACTTAAGGATTGTCTTTGTACATAACAAGGCAGTTATTTGGCAGAAAAGCAGAGTATCAGATCACAAGATGGCTCTCATGTCAGTTCTGGGGACTGCTGTTATGAACAATATGGAATCCTTTCAGTACCACTCTGAAGAATCTCAGATTTATCTCAGTGGATTTCTTCCAAAGTGTGATGCAGACCACTCTTTCACTAGTCTTTCAACACCAGAAAGAAGTTTCATCTTCATAAACAGTCGACCAGTACATCAAAAAGATATCTTAAAGTTAATCCGACATCATTACAATCTGAAATGCCTAAAGGAATCTACTCGTTTGTATCCTGTTTTCTTTCTGAAAATCGATGTTCCTACAGCTGATGTTGATGTAAATTTAACACCAGATAAAAGCCAAGTATTATTACAAAATAAGGAATCTGTTTTAATTGCTCTTGAAAATCTGATGACGACTTGTTATGGACCATTACCTAGTACAAATTCTTATGAAAATAATAAAACAGATGTTTCCGCAGCTGACATCGTTCTTAGTAAAACAGCAGAAACAGATGTGCTTTTTAATAAAGTGGAATCATCTGGAAAGAATTATTCAAATGTTGATACTTCAGTCATTCCATTCCAAAATGATATGCATAATGATGAATCTGGAAAAAACACTGATGATTGTTTAAATCACCAGATAAGTATTGGTGACTTTGGTTATGGTCATTGTAGTAGTGAAATTTCTAACATTGATAAAAACACTAAGAATGCATTTCAGGACATTTCAATGAGTAATGTATCATGGGAGAACTCTCAGACGGAATATAGTAAAACTTGTTTTATAAGTTCCGTTAAGCACACCCAGTCAGAAAATGGCAATAAAGACCATATAGATGAGAGTGGGGAAAATGAGGAAGAAGCAGGTCTTGAAAACTCTTCGGAAATTTCTGCAGATGAGTGGAGCAGGGGAAATATACTTAAAAATTCAGTGGGAGAGAATATTGAACCTGTGAAAATTTTAGTGCCTGAAAAAAGTTTACCATGTAAAGTAAGTAATAATAATTATCCAATCCCTGAACAAATGAATCTTAATGAAGATTCATGTAACAAAAAATCAAATGTAATAGATAATAAATCTGGAAAAGTTACAGCTTATGATTTACTTAGCAATCGAGTAATCAAGAAACCCATGTCAGCAAGTGCTCTTTTTGTTCAAGATCATCGTCCTCAGTTTCTCATAGAAAATCCTAAGACTAGTTTAGAGGATGCAACACTACAAATTGAAGAACTGTGGAAGACATTGAGTGAAGAGGAAAAACTGAATCTTTTTAATGGATCTCATTATTTAGACGTTTTATATAAAATGACAGCAGATGACCAAAGATACAGTGGATCAACTTACCTGTCTGATCCTCGTCTTACAGCGAATGGTTTCAAGATAAAATTGATACCAGGAGTTTCAATTACTGAAAATTAATTGGAAATAGAAGGAATGGCTAATTGTCTCCCATTCTATGGAGTAGCAGATTTAAAAGAAATTCTTAATGCTATATTAAACAGAAATGCAAAGGAAGTTTATGAATGTAGACCTCGCAAAGTGATAAGTTATTTAGAGGGAGAAGCAGTGCGTCTATCCAGACAATTACCCATGTACTTATCAAAAGAGGACATCCAAGACATTATCTACAGAATGAAGCACCAGTTTGGAAATGAAATTAAAGAGTGTGTTCATGGTCGCCCAAAATTAAGAAGGGCGAATTCTGCAGATATCCATCACACTGGCGGCCGCTCGAGCATGCATCTAGAGGGCCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTATACGTACGGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATGTACAGAGTGATATTATTGACACGCCGGGGCGACGGATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCTCCCGTGAACTTTACCCGGTGGTGCATATCGGGGATGAAAGCTGGCGCATGATGACCACCGATATGGCCAGTGTGCCGGTCTCCGTTATCGGGGAAGAAGTGGCTGATCTCAGCCACCGCGAAAATGACATCAAAAACGCCATTAACCTGATGTTCTGGGGAATATAAATGTCAGGCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTCACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGGATGAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGCAGGTAGCTTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTCGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGCTCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAAGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGAGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAATTATTAACGCTTACAATTTCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATACAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATAGCACGTGAGGAGGGCCACCATGGCCAAGTTGACCAGTGCCGTTCCGGTGCTCACCGCGCGCGACGTCGCCGGAGCGGTCGAGTTCTGGACCGACCGGCTCGGGTTCTCCCGGGACTTCGTGGAGGACGACTTCGCCGGTGTGGTCCGGGACGACGTGACCCTGTTCATCAGCGCGGTCCAGGACCAGGTGGTGCCGGACAACACCCTGGCCTGGGTGTGGGTGCGCGGCCTGGACGAGCTGTACGCCGAGTGGTCGGAGGTCGTGTCCACGAACTTCCGGGACGCCTCCGGGCCGGCCATGACCGAGATCGGCGAGCAGCCGTGGGGGCGGGAGTTCGCCCTGCGCGACCCGGCCGGCAACTGCGTGCACTTCGTGGCCGAGGAGCAGGACTGACACGTGCTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAA

Sequencing Information:

Phred Score: 905
Date: 2018-11-13

Last Passing Sequencing Read:

NNNAAGCAGCTAGATAGCTTGGTACGAGCTCGGATCCACTAGTAACGGCC GCCAGTGTGCTGGAATTCAGGCCTGAATTCGCCCTTCACCGCTGCTTGCG GCTAGTGGATGGTAATTGCCTGCCTCGCGCTAGCAGGAAGCTGCTCTGTT AAAGCGAAAATGAAACAATTGCCTGCGGCAACAGTTCGACTCCTTTCAAG TTCTCAGATCATCACTTCGGTGGTCAGTGTTGTAAAAGAGCTTATTGAAA ACTCCTTGGATGCTGGTGCCACAAGCGTAGATGTTAAACTGGAGAACTAT GGATTTGATAAAATTGAGGTGCGAGATAACGGGGAGGGTATCAAGGCTGT TGATGCACCTGTAATGGCAATGAAGTACTACACCTCAAAAATAAATAGTC ATGAAGATCTTGAAAATTTGACAACTTACGGTTTTCGTGGAGAAGCCTTG GGGTCAATTTGTTGTATAGCTGAGGTTTTAATTACAACAAGAACGGCTGC TGATAATTTTAGCACCCAGTATGTTTTAGATGGCAGTGGCCACATACTTT CTCAGAAACCTTCACATCTTGGTCAAGGTACAACTGTAACTGCTTTAAGA TTATTTAAGAATCTACCTGTAAGAAAGCAGTTTTACTCAACTGCAAAAAA ATGTAAAGATGAAATAAAAAAGATCCAAGATCTCCTCATGAGCTTTGGTA TCCTTAAACCTGACTTAAGGATTGTCTTTGTACATAACAAGGCAGTTATT TGGCAGAAAAGCAGAGTATCAGATCACAAGATGGCTCTCATGTCAGTTCT GGGGACTGCTGTTATGAACAATATGGAATCCTTTCAGTACCACTCTGAAG AATCTCAGATTTATCTCAGTGGATTTCTTCCCAAGTGTGATGCAGACCAC TCTTTCACTAGTCTTTCAACACCAGAAAGAAGTTTCATCTTCATAAACAG TCGAACAGTACATCAAAAAGATATCTTAAAGTTAATCCGACATCATTACA ATCTGAAATGCCTAAAGGAATCTACTCGTTTGTATCCTGTTTTCTTCTNG AAATNCGATGTCCTACAGCTGATGTTGATGTAAATTTAACACCGATAAAA GCCAGTATTATACAAATAGGAATCTGTTTAATGCTCTGAAATCTGAGACG ACTGTATGACCATACTAGTACAATCTTAGAAATATAAACGAGGTTCCCAC TGACTCGTCTAAAAACAGCGACACAAGTGCTTTATAAGGGAACTCGGAAG ATTTCCAAGTGAACTCGCCTCCCTCAAGGAAGCAAGGGAACGGAAAACGG GATTTAACCCAAAATTGGCATTGTTGGCTTGNNGGATTCAATGAAAAAAA GGGTCGTTTTGGAGTTGGGACCCAAAATAATTTTTTCTCCCCAAAGGAAA

Vector Information:

Vector Name:pCR-BluntII-TOPO
Type:bacterial plasmid
Description:TOPO Cloning vector for bacterial expression; kanamycin resistance in bacteria
Properties:bacterial expression
Comments:PCR cloning vector, cloning site between the EcoRI sites (capitalized) as follows: GAATTCgccctt--cDNA INSERT--agggcGAATTC. The vector contains the ccdB gene fused to the C-terminus of the LacZa fragment. Ligation of a blunt-end PCR product disrupts expression of the lacZa-ccdB gene fusion permitting growth of only positive recombinants upon transformation. Cells that contain non-recombinant vector are killed upon plating. Therefore, blue/white screening is not required.
Map:pCRBluntIITopo.bmp
Sequence:pCR_BluntII_TOPO.txt
Size (bp):3519
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha N

Antibiotic Selections:

Host Type Marker
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 50ug/mL kanamycin Growth with the single antibiotic in LB at 37 degrees is recommended. Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.

Authors:

Author Name Author Type
MGC Consortium