Clone: HsCD00345723

Clone ID:HsCD00345723
Is Verified:Y
Status:AVAILABLE
Source:MGC
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

IMAGE ID 30915240
GI 50603896
GenBank Accession BC074882
Original Clone ID MGC:103858

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 881 Homo sapiens CLOSED 1734 DIO2 deiodinase, iodothyronine, type II
Insert1
Size (bp)881
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 1734
Gene SymbolDIO2
Gene Namedeiodinase, iodothyronine, type II
Keyword

Insert Sequence:

CACAAGGGAACTGACTCAGGAGGCAGAGAAGATGGGCATCCTCAGCGTAGACTTGCTGATCACACTGCAAATTCTGCCAGTTTTTTTCTCCAACTGCCTCTTCCTGGCTCTCTATGACTCGGTCATTCTGCTCAAGCACGTGGTGCTGCTGTTGAGCCGCTCCAAGTCCACTCGCGGAGAGTGGCGGCGCATGCTGACCTCAGAGGGACTGCGCTGCGTCTGGAAGAGCTTCCTCCTCGATGCCTACAAACAGGTGAAATTGGGTGAGGATGCCCCCAATTCCAGTGTGGTGCATGTCTCCAGTACAGAAGGAGGTGACAACAGTGGCAATGGTACCCAGGAGAAGATAGCTGAGGGAGCCACATGCCACCTTCTTGACTTTGCCAGCCCTGAGCGCCCACTAGTGGTCAACTTTGGCTCAGCCACTTGACCTCCTTTCACGAGCCAGCTGCCAGCCTTCCGCAAACTGGTGGAAGAGTTCTCCTCAGTGGCTGACTTCCTGCTGGTCTACATTGATGAGGCTCATCCATCAGATGGCTGGGCGATACCGGGGGACTCCTCTTTGTCTTTTGAGGTGAAGAAGCACCAGAACCAGGAAGATCGATGTGCAGCAGCCCAGCAGCTTCTGGAGCGTTTCTCCTTGCCGCCCCAGTGCCGAGTTGTGGCTGACCGCATGGACAATAACGCCAACATAGCTTACGGGGTAGCCTTTGAACGTGTGTGCATTGTGCAGAGACAGAAAATTGCTTATCTGGGAGGAAAGGGCCCCTTCTCCTACAACCTTCAAGAAGTCCGGCATTGGCTGGAGAAGAATTTCAGCAAGAGATGAAAGAAAACTAGATTAGCTGGTTAAAGGTATGATTATAAGAGAGCTTATTGTT

Insert Property: Insert 1

Type Value Extra Information
CDS Start 32
CDS Stop 853

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

AGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTCAGAATTAACCCTCACTAAAGGGACTAGTCCTGCAGGTTTAAACGAATTCGCCCTTCACAAGGGAACTGACTCAGGAGGCAGAGAAGATGGGCATCCTCAGCGTAGACTTGCTGATCACACTGCAAATTCTGCCAGTTTTTTTCTCCAACTGCCTCTTCCTGGCTCTCTATGACTCGGTCATTCTGCTCAAGCACGTGGTGCTGCTGTTGAGCCGCTCCAAGTCCACTCGCGGAGAGTGGCGGCGCATGCTGACCTCAGAGGGACTGCGCTGCGTCTGGAAGAGCTTCCTCCTCGATGCCTACAAACAGGTGAAATTGGGTGAGGATGCCCCCAATTCCAGTGTGGTGCATGTCTCCAGTACAGAAGGAGGTGACAACAGTGGCAATGGTACCCAGGAGAAGATAGCTGAGGGAGCCACATGCCACCTTCTTGACTTTGCCAGCCCTGAGCGCCCACTAGTGGTCAACTTTGGCTCAGCCACTTGACCTCCTTTCACGAGCCAGCTGCCAGCCTTCCGCAAACTGGTGGAAGAGTTCTCCTCAGTGGCTGACTTCCTGCTGGTCTACATTGATGAGGCTCATCCATCAGATGGCTGGGCGATACCGGGGGACTCCTCTTTGTCTTTTGAGGTGAAGAAGCACCAGAACCAGGAAGATCGATGTGCAGCAGCCCAGCAGCTTCTGGAGCGTTTCTCCTTGCCGCCCCAGTGCCGAGTTGTGGCTGACCGCATGGACAATAACGCCAACATAGCTTACGGGGTAGCCTTTGAACGTGTGTGCATTGTGCAGAGACAGAAAATTGCTTATCTGGGAGGAAAGGGCCCCTTCTCCTACAACCTTCAAGAAGTCCGGCATTGGCTGGAGAAGAATTTCAGCAAGAGATGAAAGAAAACTAGATTAGCTGGTTAAAGGTATGATTATAAGAGAGCTTATTGTTAGTTCGAGAAGGGCGAATTCGCGGCCGCTAAATTCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTATACGTACGGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATGTACAGAGTGATATTATTGACACGCCGGGGCGACGGATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCTCCCGTGAACTTTACCCGGTGGTGCATATCGGGGATGAAAGCTGGCGCATGATGACCACCGATATGGCCAGTGTGCCGGTCTCCGTTATCGGGGAAGAAGTGGCTGATCTCAGCCACCGCGAAAATGACATCAAAAACGCCATTAACCTGATGTTCTGGGGAATATAAATGTCAGGCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTCACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGGATGAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGCAGGTAGCTTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGCTCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAAGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGAGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAATTATTAACGCTTACAATTTCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAA

Sequencing Information:

Phred Score: 807
Date: 2013-10-21

Last Passing Sequencing Read:

NNNNCCGACTATGGCGAATGATTAGCGGCCGCGAATCGCCCTTCACAAGGGAACTGACTCAGGAGGCAGAGAAGATGGGCATCCTCAGCGTAGACTTGCTGATCACACTGCAAATTCTGCCAGTTTTTTTCTCCAACTGCCTCTTCCTGGCTCTCTATGACTCGGTCATTCTGCTCAAGCACGTGGTGCTGCTGTTGAGCCGCTCCAAGTCCACTCGCGGAGAGTGGCGGCGCATGCTGACCTCAGAGGGACTGCGCTGCGTCTGGAAGAGCTTCCTCCTCGATGCCTACAAACAGGTGAAATTGGGTGAGGATGCCCCCAATTCCAGTGTGGTGCATGTCTCCAGTACAGAAGGAGGTGACAACAGTGGCAATGGTACCCAGGAGAAGATAGCTGAGGGAGCCACATGCCACCTTCTTGACTTTGCCAGCCCTGAGCGCCCACTAGTGGTCAACTTTGGCTCAGCCACTTGACCTCCTTTCACGAGCCAGCTGCCAGCCTTCCGCAAACTGGTGGAAGAGTTCTCCTCAGTGGCTGACTTCCTGCTGGTCTACATTGATGAGGCTCATCCATCAGATGGCTGGGCGATACCGGGGGACTCCTCTTTGTCTTTTGAGGTGAAGAAGCACCAGAACCAGGAAGATCGATGTGCAGCAGCCCAGCAGCTTCTGGAGCGTTTCTCCTTGCCGCCCCAGTGCCGAGTTGTGGCTGACCGCATGGACAATAACGCCAACATAGCTTACGGGGTAGCCTTTGAACGTGTGTGCATTGTGCAGAGACAGAAAATTGCTTATCTGGGAGGAAAGGGCCCCTTCTCCTACAACCTTCAAGAAAGTCGGCATTGGCTGGAGAAGATTTTCAGCAGAGATGAAAGAAACTAGATTAGCTGGTTAAGGTATGAATATAAGAGAGCTTATTGTAANGGCGAATCGTTTAACCTGCAGGACTAGTCCTTTAGTGAGGGTTAATCTGAGCTGNCGTATCATGGTCTAGCTGTTTCTGTGTGAATGTTATCGCTCACATCCACACACATACGAGCCGAGCATAAGTGTAAAGCTGGGGTGCCTATGAGTGACTACTCCATTAATGCGTGGGTTCCTGCCCCTTCCAGCGGGACCTGCCTGCCGCTGCATATGATCGCCAACCCGGGAAAGGCGTTTCCATTGGGGCTTCCCTTCCCCACAAAAACCTGCCCGGGTTTGGTGGGGAAGGTTTCTCCTTAAGGGGGTCGGTTTCCCAAAAGGGAACCCGAAAAATTTTTAAAGCCAAAGGCGGACCAAAAGCCGGTGGGTTTTAAGCC

Vector Information:

Vector Name:pCR4-TOPO
Type:bacterial plasmid
Description:TOPO Cloning vector with ampicillin resistance in bacteria.
Properties:TOPO Cloning
Comments:
Map:pCR4TopoTA.bmp
Sequence:CR4Topo.txt
Size (bp):3956
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
MGC Consortium