Clone: HsCD00345680

Clone ID:HsCD00345680
Is Verified:Y
Status:AVAILABLE
Source:MGC
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

IMAGE ID 30915190
GI 50960041
Original Clone ID MGC:103809
GenBank Accession BC074769

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 1139 Homo sapiens CLOSED 141 ADPRH ADP-ribosylarginine hydrolase
Insert1
Size (bp)1139
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 141
Gene SymbolADPRH
Gene NameADP-ribosylarginine hydrolase
Keyword

Insert Sequence:

AAGACACCCTCTCCAGAGCCCAGCAATTGTGAGGGACTGATGGAGAAGTATGTGGCTGCTATGGTGCTGAGTGCAGCTGGAGATGCCCTGGGGTACTACAATGGGAAGTGGGAGTTCCTCCAGGATGGGGAGAAGATACACCGGCAGTTGGCCCAGCTGGGCGGCTTGGATGCCCTAGACGTGGGAAGGTGGAGAGTTAGTGACGACACAGTGATGCACTTGGCCACAGCAGAAGCTCTTGTGGAAGCTGGGAAAGCCCCTAAGTTGACTCAACTGTATTACCTCCTTGCTAAGCATTACCAAGACTGCATGGAAGACATGGATGGGCGGGCACCAGGTGGTGCCTCGGTGCACAACGCCATGCAGCTGAAGCCGGGCAAGCCCAATGGCTGGAGGATTCCCTTCAACAGCCATGAGGGCGGCTGTGGGGCTGCCATGCGGGCCATGTGCATCGGTCTCAGGTTCCCACACCATAGCCAACTGGACACACTGATCCAAGTGAGCATCGAGAGTGGTCGGATGACCCACCACCACCCAACAGGCTACCTGGGGGCCCTTGCGTCTGCTCTTTTTACAGCCTATGCTGTGAATAGCAGACCACCCTTGCAGTGGGGAAAAGGACTGATGGAGCTGCTACCAGAAGCTAAAAAGTACATTGTCCAATCAGGCTACTTTGTAGAGGAAAATCTTCAACACTGGTCCTACTTCCAAACCAAATGGGAAAATTACCTAAAACTTAGAGGGATTTTGGATGGAGAATCAGCCCCTACCTTCCCTGAGTCTTTCGGTGTGAAGGAGAGGGATCAGTTCTACACCTCCCTGAGCTACTCTGGCTGGGGTGGCAGCAGTGGGCACGATGCCCCCATGATTGCCTACGATGCTGTTCTTGCTGCAGGAGACTCCTGGAAGGAGCTTGCCCACCGAGCCTTTTTCCATGGTGGAGACAGTGATTCTACAGCTGCCATTGCTGGCTGCTGGTGGGGAGTTATGTATGGTTTTAAAGGAGTGAGTCCCTCCAACTATGAGAAACTAGAATACAGAAACCGGCTGGAAGAGACAGCTAGGGCTTTATATTCTCTCGGGTCAAAAGAAGACACTGTAATTTCCCTTTAGGGAGACGTGATGTTCACTTCTGATGG

Insert Property: Insert 1

Type Value Extra Information
CDS Start 40
CDS Stop 1113

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

AGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTCAGAATTAACCCTCACTAAAGGGACTAGTCCTGCAGGTTTAAACGAATTCGCCCTTAAGACACCCTCTCCAGAGCCCAGCAATTGTGAGGGACTGATGGAGAAGTATGTGGCTGCTATGGTGCTGAGTGCAGCTGGAGATGCCCTGGGGTACTACAATGGGAAGTGGGAGTTCCTCCAGGATGGGGAGAAGATACACCGGCAGTTGGCCCAGCTGGGCGGCTTGGATGCCCTAGACGTGGGAAGGTGGAGAGTTAGTGACGACACAGTGATGCACTTGGCCACAGCAGAAGCTCTTGTGGAAGCTGGGAAAGCCCCTAAGTTGACTCAACTGTATTACCTCCTTGCTAAGCATTACCAAGACTGCATGGAAGACATGGATGGGCGGGCACCAGGTGGTGCCTCGGTGCACAACGCCATGCAGCTGAAGCCGGGCAAGCCCAATGGCTGGAGGATTCCCTTCAACAGCCATGAGGGCGGCTGTGGGGCTGCCATGCGGGCCATGTGCATCGGTCTCAGGTTCCCACACCATAGCCAACTGGACACACTGATCCAAGTGAGCATCGAGAGTGGTCGGATGACCCACCACCACCCAACAGGCTACCTGGGGGCCCTTGCGTCTGCTCTTTTTACAGCCTATGCTGTGAATAGCAGACCACCCTTGCAGTGGGGAAAAGGACTGATGGAGCTGCTACCAGAAGCTAAAAAGTACATTGTCCAATCAGGCTACTTTGTAGAGGAAAATCTTCAACACTGGTCCTACTTCCAAACCAAATGGGAAAATTACCTAAAACTTAGAGGGATTTTGGATGGAGAATCAGCCCCTACCTTCCCTGAGTCTTTCGGTGTGAAGGAGAGGGATCAGTTCTACACCTCCCTGAGCTACTCTGGCTGGGGTGGCAGCAGTGGGCACGATGCCCCCATGATTGCCTACGATGCTGTTCTTGCTGCAGGAGACTCCTGGAAGGAGCTTGCCCACCGAGCCTTTTTCCATGGTGGAGACAGTGATTCTACAGCTGCCATTGCTGGCTGCTGGTGGGGAGTTATGTATGGTTTTAAAGGAGTGAGTCCCTCCAACTATGAGAAACTAGAATACAGAAACCGGCTGGAAGAGACAGCTAGGGCTTTATATTCTCTCGGGTCAAAAGAAGACACTGTAATTTCCCTTTAGGGAGACGTGATGTTCACTTCTGATGGAGTTCGAGAAGGGCGAATTCGCGGCCGCTAAATTCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTATACGTACGGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATGTACAGAGTGATATTATTGACACGCCGGGGCGACGGATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCTCCCGTGAACTTTACCCGGTGGTGCATATCGGGGATGAAAGCTGGCGCATGATGACCACCGATATGGCCAGTGTGCCGGTCTCCGTTATCGGGGAAGAAGTGGCTGATCTCAGCCACCGCGAAAATGACATCAAAAACGCCATTAACCTGATGTTCTGGGGAATATAAATGTCAGGCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTCACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGGATGAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGCAGGTAGCTTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGCTCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAAGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGAGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAATTATTAACGCTTACAATTTCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAA

Sequencing Information:

Phred Score: 878
Date: 2015-09-29

Last Passing Sequencing Read:

NNNGGAATACTTAGGCGATTGATTAGCGGCCGCGAATTCGCCCTTAAGACACCCTCTCCAGAGCCCAGCAATTGTGAGGGACTGATGGAGAAGTATGTGGCTGCTATGGTGCTGAGTGCAGCTGGAGATGCCCTGGGGTACTACAATGGGAAGTGGGAGTTCCTCCAGGATGGGGAGAAGATACACCGGCAGTTGGCCCAGCTGGGCGGCTTGGATGCCCTAGACGTGGGAAGGTGGAGAGTTAGTGACGACACAGTGATGCACTTGGCCACAGCAGAAGCTCTTGTGGAAGCTGGGAAAGCCCCTAAGTTGACTCAACTGTATTACCTCCTTGCTAAGCATTACCAAGACTGCATGGAAGACATGGATGGGCGGGCACCAGGTGGTGCCTCGGTGCACAACGCCATGCAGCTGAAGCCGGGCAAGCCCAATGGCTGGAGGATTCCCTTCAACAGCCATGAGGGCGGCTGTGGGGCTGCCATGCGGGCCATGTGCATCGGTCTCAGGTTCCCACACCATAGCCAACTGGACACACTGATCCAAGTGAGCATCGAGAGTGGTCGGATGACCCACCACCACCCAACAGGCTACCTGGGGGCCCTTGCGTCTGCTCTTTTTACAGCCTATGCTGTGAATAGCAGACCACCCTTGCAGTGGGGAAAAGGACTGATGGAGCTGCTACCAGAAGCTAAAAAGTACATTGTCCAATCAGGCTACTTTGTAGAGGAAAATCTTCAACACTGGTCCTACTTCCAAACCAAATGGGAAAATTACCTAAAACTTAGAGGGATTTTGGATGGAGAATCAGCCCCTACCTTCCCTGAGTCTTTCGGTGTGAAGGAGAGGGATCAGTTCTACACCTCCCTGAGCTACTCTGGCTGGGGTGGCAGCAGTGGGCACGATGCCCCCATGATTGCCTACGATGCTGTTCTTGCTGCANGAGACTCCTGNAANGAGCTTGCCNNACGAGNCTTTTTNCATGGTGNAGACAGTGATTCTACAGCTGCCATTGCTGGCTGCTGGTGGGGAGTTATGTATGGTTTTAAAGGAGTGAGTCCCTCCCACTTGAAAAACTGAATACGAAACCGGCTGAAAAAAACGCTAGGGCTTAAATTCTCTCGGTCAAAGAGAACCTGTAATTCCCTTNAGAAAACTGATGTTCCTCTGATGAAGGGCAATTCGTTAACCTGCAGACTGTCCTTTAGGAGGGTATTCCGACTTGCGAAACGGCCAAACGTTTCCGGGGAAATTTTTCCCCCCAATTCCCCAAATAAAACCGAACATATGTTAAACGGGGGCC

Vector Information:

Vector Name:pCR4-TOPO
Type:bacterial plasmid
Description:TOPO Cloning vector with ampicillin resistance in bacteria.
Properties:TOPO Cloning
Comments:
Map:pCR4TopoTA.bmp
Sequence:CR4Topo.txt
Size (bp):3956
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
MGC Consortium