Clone: HsCD00345576

Clone ID:HsCD00345576
Is Verified:Y
Status:AVAILABLE
Source:MGC
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

IMAGE ID 30407481
GI 45751570
GenBank Accession BC068030
Original Clone ID MGC:75418

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 2002 Homo sapiens CLOSED 1270 CNTF ciliary neurotrophic factor
Insert1
Size (bp)2002
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 1270
Gene SymbolCNTF
Gene Nameciliary neurotrophic factor
Keyword

Insert Sequence:

CACATCTCTTATTTGGACCAGTATAGACAGAAGTAAACCCAGCTGACTTGTTTCCTGGGACAGTTGAGTTAAGGGATGGCTTTCACAGAGCATTCACCGCTGACCCCTCACCGTCGGGACCTCTGTAGCCGCTCTATCTGGCTAGCAAGGAAGATTCGTTCAGACCTGACTGCTCTTACGGAATCCTATGTGAAGCATCAGGGCCTGAACAAGAACATCAACCTGGACTCTGCGGATGGGATGCCAGTGGCAAGCACTGATCAGTGGAGTGAGCTGACCGAGGCAGAGCGACTCCAAGAGAACCTTCAAGCTTATCGTACCTTCCATGTTTTGTTGGCCAGGCTCTTAGAAGACCAGCAGGTGCATTTTACCCCAACCGAAGGTGACTTCCATCAAGCTATACATACCCTTCTTCTCCAAGTCGCTGCCTTTGCATACCAGATAGAGGAGTTAATGATACTCCTGGAATACAAGATCCCCCGCAATGAGGCTGATGGGATGCCTATTAATGTTGGAGATGGTGGTCTCTTTGAGAAGAAGCTGTGGGGCCTAAAGGTGCTGCAGGAGCTTTCACAGTGGACAGTAAGGTCCATCCATGACCTTCGTTTCATTTCTTCTCATCAGACTGGGATCCCAGCACGTGGGAGCCATTATATTGCTAACAACAAGAAAATGTAGCAGTTAGTCCCTTCTCTCTTCCTTGCTTTCTCTTCTAATGGAATATGCGTAGTTCCCTGGGGCCTCGCTTTCCCATCTTAAATTTCTAAAAACAGTTAAGACAACAGGCATTTTCTTTCTTTTTTCTCTGACCACCTGCAGCCTGTTGAAGGACTACAGGTATTTTCATCAAGTAGCGTTGGAGACATACACAAATGGGCATACAAGTTTAGCCTGGGGGGTGTGATTTGTGTGCGTGCTTGCATGTGCTGCAGGTGTAAGAGAGTGGGAGCAGGGACAACGTCCTTCCACTTCAGGGTTCTAACCTTTCTAACCCACTAAGTAACCTCTACAGGCATTTAACTGCCTTACAGACAGAATATACATATGTTAATTCTAGTCCTGGATGACTCGGTCTGAGAAGATTCAATTTAAAATCAGACTCTTTAGTTGATTTAAACTCTTAGAGAATAAGAATAATAATGGCTAACTTTTATTATCTTCTATATTAAGGCAGTATGCCAAGGGTCTTTATGTATATTATGTACAGCGTTTACAACCTTGTGAGCAAGGTGGTGTTACTCCCATTAGGTAGATGAGAAAACAGGCTCACAGAGATTTGGTTAAGCTCACACAGCTAACAAGTAGCACACTGAGTTTGAACACAGATCATTCTCCTTGTAAAAGCCTATGTGCCTTTCACTTTAGAGGCTTGATCATGAATCACTGCACCTCTTTGTCACAGGGTGTTGGAAGATGCATCCATGTAATCTATTCCCATCGCTGGAAAACAGCTGCTGTTAGATGTCCTCAGAAGTCAGTTGCAAATTTTAGCGTTAAAGTCAGGATTTATTGTTCATACTTGGCGGTGAGGAGGGCAGCTGGAGATCTTAAGATTCCATTTTGGAAAATGATTAGGCCCGCCAAACTTCTGAACTTTGGAAGCTGGGGATGTTTAGTAATACAGCCTGGTTTTCAAGTACTCACTAAAAGTTCTCAAATATTGGGTTGGGCACGGCTTATACCAGGTTACCTCACTTTTAATTAGTGATGCAGGCAGTGTAACCCAAGCATTTGTGGACAATGAGTGGAATACTAAAGTTAAAAAGTCAAACTTTCACCTCAGATTTTCTGGACTTAGTCATGAGGAGAGGGTGAGGCCCACTCTGTTCCTACTGGAGATACCAGAGACTCTGAAACTATAGAATAAAGCCTCTGTGCTGCACAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

Insert Property: Insert 1

Type Value Extra Information
CDS Start 76
CDS Stop 678

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

AGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGAGCTTGCAATTCGCGCGTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTAGTACGAGGCCCTTTCACTCATTAGATGCATGTCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGGACTCTAGCCTAGGCCGCGGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATTAGGCCTATTTAGGTGACACTATAGAACAAGTTTGTACAAAAAAGCAGGCTGGTACCGGTCCGGAATTCCCGGGATCACATCTCTTATTTGGACCAGTATAGACAGAAGTAAACCCAGCTGACTTGTTTCCTGGGACAGTTGAGTTAAGGGATGGCTTTCACAGAGCATTCACCGCTGACCCCTCACCGTCGGGACCTCTGTAGCCGCTCTATCTGGCTAGCAAGGAAGATTCGTTCAGACCTGACTGCTCTTACGGAATCCTATGTGAAGCATCAGGGCCTGAACAAGAACATCAACCTGGACTCTGCGGATGGGATGCCAGTGGCAAGCACTGATCAGTGGAGTGAGCTGACCGAGGCAGAGCGACTCCAAGAGAACCTTCAAGCTTATCGTACCTTCCATGTTTTGTTGGCCAGGCTCTTAGAAGACCAGCAGGTGCATTTTACCCCAACCGAAGGTGACTTCCATCAAGCTATACATACCCTTCTTCTCCAAGTCGCTGCCTTTGCATACCAGATAGAGGAGTTAATGATACTCCTGGAATACAAGATCCCCCGCAATGAGGCTGATGGGATGCCTATTAATGTTGGAGATGGTGGTCTCTTTGAGAAGAAGCTGTGGGGCCTAAAGGTGCTGCAGGAGCTTTCACAGTGGACAGTAAGGTCCATCCATGACCTTCGTTTCATTTCTTCTCATCAGACTGGGATCCCAGCACGTGGGAGCCATTATATTGCTAACAACAAGAAAATGTAGCAGTTAGTCCCTTCTCTCTTCCTTGCTTTCTCTTCTAATGGAATATGCGTAGTTCCCTGGGGCCTCGCTTTCCCATCTTAAATTTCTAAAAACAGTTAAGACAACAGGCATTTTCTTTCTTTTTTCTCTGACCACCTGCAGCCTGTTGAAGGACTACAGGTATTTTCATCAAGTAGCGTTGGAGACATACACAAATGGGCATACAAGTTTAGCCTGGGGGGTGTGATTTGTGTGCGTGCTTGCATGTGCTGCAGGTGTAAGAGAGTGGGAGCAGGGACAACGTCCTTCCACTTCAGGGTTCTAACCTTTCTAACCCACTAAGTAACCTCTACAGGCATTTAACTGCCTTACAGACAGAATATACATATGTTAATTCTAGTCCTGGATGACTCGGTCTGAGAAGATTCAATTTAAAATCAGACTCTTTAGTTGATTTAAACTCTTAGAGAATAAGAATAATAATGGCTAACTTTTATTATCTTCTATATTAAGGCAGTATGCCAAGGGTCTTTATGTATATTATGTACAGCGTTTACAACCTTGTGAGCAAGGTGGTGTTACTCCCATTAGGTAGATGAGAAAACAGGCTCACAGAGATTTGGTTAAGCTCACACAGCTAACAAGTAGCACACTGAGTTTGAACACAGATCATTCTCCTTGTAAAAGCCTATGTGCCTTTCACTTTAGAGGCTTGATCATGAATCACTGCACCTCTTTGTCACAGGGTGTTGGAAGATGCATCCATGTAATCTATTCCCATCGCTGGAAAACAGCTGCTGTTAGATGTCCTCAGAAGTCAGTTGCAAATTTTAGCGTTAAAGTCAGGATTTATTGTTCATACTTGGCGGTGAGGAGGGCAGCTGGAGATCTTAAGATTCCATTTTGGAAAATGATTAGGCCCGCCAAACTTCTGAACTTTGGAAGCTGGGGATGTTTAGTAATACAGCCTGGTTTTCAAGTACTCACTAAAAGTTCTCAAATATTGGGTTGGGCACGGCTTATACCAGGTTACCTCACTTTTAATTAGTGATGCAGGCAGTGTAACCCAAGCATTTGTGGACAATGAGTGGAATACTAAAGTTAAAAAGTCAAACTTTCACCTCAGATTTTCTGGACTTAGTCATGAGGAGAGGGTGAGGCCCACTCTGTTCCTACTGGAGATACCAGAGACTCTGAAACTATAGAATAAAGCCTCTGTGCTGCACAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGCGGCCGCTCTAGAGTATCCCTCGAGGGGCCCAAGCTTACGCGTACCCAGCTTTCTTGTACAAAGTGGTCCCTATAGTGAGTCGTATTATAAGCTAGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACTGCTAGCTTGGGATCTTTGTGAAGGAACCTTACTTCTGTGGTGTGACATAATTGGACAAACTACCTACAGAGATTTAAAGCTCTAAGGTAAATATAAAATTTTTAAGTGTATAATGTGTTAAACTAGCTGCATATGCTTGCTGCTTGAGAGTTTTGCTTACTGAGTATGATTTATGAAAATATTATACACAGGAGCTAGTGATTCTAATTGTTTGTGTATTTTAGATTCACAGTCCCAAGGCTCATTTCAGGCCCCTCAGTCCTCACAGTCTGTTCATGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCGATCCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAA

Sequencing Information:

Phred Score: 897
Date: 2015-09-21

Last Passing Sequencing Read:

ATTCGCCCTTAAGCAAGGAAGAGAGAAGGGACTAACTGCTACATTTTCTTGTTGTTAGCAATATAATGGCTCCCACGTGCTGGGATCCCAGTCTGATGAGAAGAAATGAAACGAAGGTCATGGATGGACCTTACTGTCCACTGTGAAAGCTCCTGCAGCACCTTTAGGCCCCACAGCTTCTTCTCAAAGAGACCACCATCTCCAACATTAATAGGCATCCCATCAGCCTCATTGCGGGGGATCTTGTATTCCAGGAGTATCATTAACTCCTCTATCTGGTATGCAAAGGCAGCGACTTGGAGAAGAAGGGTATGTATAGCTTGATGGAAGTCACCTTCGGTTGGGGTAAAATGCACCTGCTGGTCTTCTAAGAGCCTGGCCAACAAAACATGGAAGGTACGATAAGCTTGAAGGTTCTCTTGGAGTCGCTCTGCCTCGGTCAGCTCACTCCACTGATCAGTGCTTGCCACTGGCATCCCATCCGCAGAGTCCAGGTTGATGTTCTTGTTCAGGCCCTGATGCTTCACATAGGATTCCGTAAGAGCAGTCAGGTCTGAACGAATCTTCCTTGCTAGCCAGATAGAGCGGCTACAGAGGTCCCGACGGTGAGGGGTCAGCGGTGAATGCTCTGTGAAAGCCATCCCTTAACTCAACTGTCCCAGGAAACAAGTCAGCAAGGGCGAATTCGTTTAAACCTGCAGGACTAGTCCCTTTAGTGAGGGTTAATTCTGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACT

Vector Information:

Vector Name:pCMV-SPORT6.1
Type:bacterial plasmid
Description:Gateway vector with CMV promoter and ampicillin resistance in bacteria
Properties:mammalian expression
Comments:also known as pCMV-SPORT6.1.ccdb
Map:pcmv-sport6_1.gif
Sequence:pCMV_Sport_6_1.txt
Size (bp):4175
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
MGC Consortium