Clone: HsCD00343330

Clone ID:HsCD00343330
Is Verified:Y
Status:AVAILABLE
Source:MGC
Description:
Comments: WARNING!!! Short Coding Sequence
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

Original Clone ID MGC:71646
GenBank Accession BC063296
IMAGE ID 30345912
GI 38648774

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 5699 Homo sapiens 54893 MTMR10 myotubularin related protein 10
Insert1
Size (bp)5699
SpeciesHomo sapiens
Format
Tissue Source
Species Specific ID 54893
Gene SymbolMTMR10
Gene Namemyotubularin related protein 10
Keyword

Insert Sequence:

GAAAGGGCCTGGGCGGCCGCACTGAGAGCTTTACGCCCGGAGGCGTCGGCGCTGCCACTGGCCCGCGACGGGAACGGGGCGAAAAGGCGGCGGCACCATGTTCTCCCTCAAGCCGCCCAAACCCACCTTCAGGTCCTACCTCCTGCCACCGCCCCAGACTGACGATAAGATCAATTCGGAACCGAAGATTAAAAAACTGGAGCCAGTCCTTTTGCCAGGAGAAATTGTCGTAAATGAAGTCAATTTTGTGAGAAAATGCATTGCAACAGACACAAGCCAGTACGATTTGTGGGGAAAGCTGATATGCAGTAACTTCAAAATCTCCTTTATTACAGATGACCCAATGCCATTACAGAAATTCCATTACAGAAACCTTCTTCTTGGTGAACACGATGTCCCTTTAACATGTATTGAACAAATTGTCACAGTAAACGACCACAAGAGGAAGCAGAAAGTCCTAGGCCCCAACCAGAAACTGAAATTTAATCCAACAGAGTTAATTATTTATTGTAAAGATTTCAGAATTGTCAGATTTCGCTTTGATGAATCAGGTCCCGAAAGTGCTAAAAAGCAAACAAAATTAATGGAATTCCCTCAGGAGATGGAGGAGGAGGAGGAGGAGGAGGTAATGGAGCTGGTGGTGGCAGCAGCCAGAAAACTCCACTCTTTGAAACTTACTCGGATTGGGACAGAGAAATCAAGAGGACAGGTGCTTCCGGGTGGAGAGTTTGTTCTATTAACGAGGGTTACATGATATCCACTTGCCTTCCAGAATACATTGTAGTGCCAAGTTCTTTAGCAGACCAAGATCTAAAGATCTTTTCCCATTCTTTTGTTGGGAGAAGGATGCCACTCTGGTGCTGGAGCCACTCTAACGGCAGTGCTCTTGTGCGAATGGCCCTCATCAAAGACGTGCTGCAGCAGAGGAAGATTGACCAGAGGATTTGTAATGCAATAACTAAAAGTCACCCACAGAGAAGTGATGTTTACAAATCAGATTTGGATAAGACCTTGCCTAATATTCAAGAAGTACAGGCAGCATTTGTAAAACTGAAGCAGCTATGCGTTAATGAGCCTTTTGAAGAAACTGAAGAGAAATGGTTATCTTCACTGGAAAATACTCGATGGTTAGAATATGTAAGGGCATTCCTTAAGCATTCAGCAGAACTTGTATACATGCTAGAAAGCAAACATCTCTCTGTAGTCCTACAAGAGGAGGAAGGAAGAGACTTGAGCTGTTGTGTAGCTTCTCTTGTTCAAGTGATGCTGGATCCCTATTTTAGGACAATTACTGGATTTCAGAGTCTGATACAGAAGGAGTGGGTCATGGCAGGATATCAGTTTCTAGACAGATGCAACCATCTAAAGAGATCAGAGAAAGAGTCTCCTTTATTTTTGCTATTCTTGGATGCCACCTGGCAGCTGTTAGAACAATATCCTGCAGCTTTTGAGTTCTCCGAAACCTACCTGGCAGTGTTGTATGACAGCACCCGGATCTCACTGTTTGGCACCTTCCTGTTCAACTCCCCTCACCAGCGAGTGAAGCAAAGCACGGAATTTGCTATAAGCAAAAACATCCAATTGGGTGATGAGAAGGGCTTAAAATTCCCCTCTGTTTGGGACTGGTCTCTCCAGTTTACAGCAAAGGATCGCACCCTTTTCCATAACCCCTTCTACATTGGAAAGAGCACACCTTGTATACAGAATGGCTCCGTGAAGTCTTTTAAACGGACAAAGGTAAATCACAGCTAACAAAACGTGATGTTGGCTCACACGTAACCAAACACCTCTTTTTCAGAACAGAGAGCGTTAAAAGTAAAGGCACTTCCAAGAGTAACACTGCTAATGCGGGTTTCTGAGGGGTCATTCCCTTTTTAACTCAAATGACTGTATCCCAACTTTCTTCCTGGTGTCTGAGGCCCACAAAGTCTCAGTACCTGAGAGTGGGCAGATTGCAGCTTTGAGCCTGCAAGCCTGATTTACTAAAGCCCCATTTATCCATTTCTTGATGATTCAAGCCGCCACTGTGGCAGGGAATGCCGCCTGGCTGTGATGTAGTCATGGCCTCCTGACTGCTATATTCTTGTCCTAATAACATTCATTGTTTGCCTTTTTAATAATTCCCAAATAAATTCTTGGGATTTTTTTTGGTAGAAAATTTGCAGACTACTGAAAGGTACAGAACAAAGAATCAGACATTTGGCCTCCTGACTGCCTCTGTTCAGTTTGCCATTGTTCTTGATAGAATCGACCAGGTCTAGTGTTTTTTCTAGCCCGTCTTAGAACTTATCCTTAAGCAAATTAGTGGATAGGAGGTACTCTCATCCCGCCCCCATTCAGGCTGATAGTAACAGCCTAGGTAGAGTCAACACATAAAAAAGTGTAATTCCAGGGGAGGAGGATTAGAATAAGGACACAAAGGAAGGGAGGAAAATGTTCTTTGAGGCTGAAATTCCATTAATTTTTCATAGTATTGAGTTTATATTTGCCATTGCATCCTTCAATCTTTCTAAAAAGGGAATCCCCGGAACATAATAAAATCTCTTCTGTATAGAAAAGCTACAGCTCCACACTAAGAGGAATGCCGTCTGCCTTAAAGAATGGAATCATCAGTGACCAAGAATTACTTCCAAGGAGAAATTCATTGATATTAAAACCAAAGCCAGATCCAGCTCAGCAAACCGACAGCCAGAACAGTGATACGGAGCAGTATTTTAGAGAATGGTTTTCCAAACCCGCCAACCTGCACGGTGTTATTCTGCCACGTGTCTCTGGAACACACATAAAACTGTGGAAACTGTGCTACTTCCGCTGGGTTCCCGAGGCCCAGATCAGCCTGGGTGGCTCCATCACAGCCTTTCACAAGCTCTCCCTCCTGGCTGATGAAGTCGACGTACTGAGCAGGATGCTGCGGCAACAGCGCAGTGGCCCCCTGGAGGCCTGCTATGGGGAGCTGGGCCAGAGCAGGATGTACTTCAACGCCAGCGGCCCTCACCACACCGACACCTCGGGGACACCGGAGTTTCTCTCCTCCTCATTTCCATTTTCTCCTGTAGGGAATCTGTGCAGACGAAGCATTTTAGGAACACCATTAAGCAAATTTTTAAGTGGGGCCAAAATATGGTTGTCTACTGAGACATTAGCAAATGAAGACTAAAATAGGGTGTTTTCTGAACATTTTGAGGGAAGCTGTCAACTTTTTTCCTCTGAATTAACATTGCTAACCTAGGCGTTTGAATCTCTAATAACTTTATATGTAAGAATAATAGTTGGAATTTGCACTAATATTTAAAAACATGTTGAATCATGCTTCTTTCACACTTATTTTAAGAGAGATGTAAATTTTGTTCCTGTCCTCTTTCTGTCATTACAGGTCTGGCTCTTGTAACCGTGATCAAACTGTTCATGTTGTCTGCTACATTTTTGTCTCCATCCATTTTTCCTACCACCTCCTGAAGGCTATCTGATAGTCAGTCACATTAGCAGCCCCAGGCAGCAGACAACAGGAAAGTTAGGAAATTTGTGTTTCGTGTCATTTTTAGGAGCATCTGATAAAACCTCCAGCAGGTTTTAGGAAGTATTCATGTATTTTTCTGGTTACTTTCTGTCATCTCTAATTGAACTCACCTGATGAAGGTTCAGTGTTCTGGGGCCAGAATTTATGATTTTAGATCACCTTCTTTGGAACCTTAGATCACTGTGTTTTGAAATCATGAGTTTGCTTTTAACTTCATAGGGTCAACTTTAAAATGATATGCACTGTTAATTTTAAAGCATTTGCTGCAGATAATTAAACTTAGAAGTGCCTTTGACTTTAGGATACAAATATTACAGAAGAAAATATAATTTCACTTTTTAAAATTGGGGTGGGAAAATCCCATTGCATATTTGAAATAGGCTTTTCATACTAAGCTTCATAGCCAGAAGTCCCCAGAGTCTTGTTCCTCTGAAAGCCACTGGGGAGGGGCCTCTGGGGTGCTGATTCCACAGAGGTGTATGC TGTAGACAGGAGAGTGCCATCTATGCCAAAACTCGCCCTCAAAAACAAACAAGGCTTGCTGGGAGGCGTGCTGGGCTTGGCCATCAGTATTTCCAGTGTGGTAAACTATTGCTGGCACTTCCCCCTGGAAATAACTAATGAGGTTACGAGTTGGGCACCTGCACAGATGTCCTTCTCTCATAGTTCCTAATGCTTAGGAATAGAGGAGAAATAAAAAAATGGATTCTCTCAAAACACTGCCATTTGAATAGCGACAGAAGTGCTCCCCCAGCCCCCAACTTTGGACAGCAAAGTTGAGGAGAATGAGCAGACACAGTTGTTTTGCTTGATCTGAATCTCTCTAAAGTAAAGTATTTCCAAACTGTGTGACAAGAGCCTACCTACCACTGTAGCGGTCAAAGCTGAAGCTTCTTACAGCAGTGAAACGGGGCACCACCTCCCCCACACTCCTCATTCCCCGCTTAAAACATGGATACTTTCAAATTTGACTGTTTCTTAAACTGCCATCCTAAGATATGGAAAATTTTTATAGTAAAGTGTCTAGTTAGCTTATTTCCTTTTCTAAAACAAGTGTTTTCAAGATAACTGTATTTTACCTTTATATGTACTGAATAGCTGTTTCTTTTTGAATTATTTGCCTTTTAAAATTTGATAATGTCTCTGGATATAACAGGACAGGAGTTCTTAAAAAATATCTTAAGAAATTCACTTTATGGGTAAACCCAAGGTTTTTGCCAACTTGTTGCCTAGAAAATAAGGGCTAGTTTCAGTTTATACAAATAGAATTATTAAACATTTTACAGTCCTTGATTAGAAACCAGACCCAATCTCCTTATAACACCACAGCGTATCCTGCCATTGACAGTGTAATCACAATTCTCCCTTTTTCATTTAGCTGCTTTTTTATTATTACTAAATGTTTTGGATTGAGCATTTTTCCCTCTGTAATTTTCTTCCTTCACGTTTATTTTATTTTAACTCTTGTAGTATTTTATTGTTGTTAATTTACAAGTTTAAAAATATTAGGTACTATTAATAATGGTTAAAAATAGAAAAATGCATATTTTTGTATGATAATCAAATGTAAAATACTTTTATTTTTGCTGGACAGTTGTTATATCATGATTATTGTGCTACAGTTTATTGTGCATAATATGAAAAACAACTATGACAGCCTTCAGTCGGGCCAGGGTGAAGCTGCTTATACCACCTCTGCCGTCAGAGGGACATGTGGTGACAGCAGTGGTGTGGCTGCACAGGGCGCACTAGAGAGAGCTCAGCACCCCTGCTGCCCGCCAGCAGAGCCCGTGCTGAGGGAATGCCGCACAGATGCTGATGCACTGGGTGAAATTTCTAGTATTGAACGTAAAGGTGTACAGTGTCTTGCTGTTATTTTATGATGGAAACTGATTTTGAAACCAAAAATAGCTAACTAACTTTATTTAAGGAAAGGATATTAATTTGTACTAACAGAGGGTGAAAGCTGTTCACATTTGTCAACAAAATCTGCTTGCTGCAGTAGTAACCTCAAGTGGTTAAAACTTGATTTCCCGAGAAAACTAAAACCTTTGTGCCTAAAACTGATGACTTGAGTTCAAGTGGGATGAGCAAGAAGATGTGTTATCTTGTTGTTCAACAGTATTGAGTGTGAAGGAAATTTTGATGGCTTAATAAAATTCCACAGCAAAAAAAAAAAAAA

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

GCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGAGCTCCACCGCGGTGGCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATGGATCAGGCCAAATCGGCCGAGCTCGAATTCGTCGAGAGCGGGAAAGGGCCTGGGCGGCCGCACTGAGAGCTTTACGCCCGGAGGCGTCGGCGCTGCCACTGGCCCGCGACGGGAACGGGGCGAAAAGGCGGCGGCACCATGTTCTCCCTCAAGCCGCCCAAACCCACCTTCAGGTCCTACCTCCTGCCACCGCCCCAGACTGACGATAAGATCAATTCGGAACCGAAGATTAAAAAACTGGAGCCAGTCCTTTTGCCAGGAGAAATTGTCGTAAATGAAGTCAATTTTGTGAGAAAATGCATTGCAACAGACACAAGCCAGTACGATTTGTGGGGAAAGCTGATATGCAGTAACTTCAAAATCTCCTTTATTACAGATGACCCAATGCCATTACAGAAATTCCATTACAGAAACCTTCTTCTTGGTGAACACGATGTCCCTTTAACATGTATTGAACAAATTGTCACAGTAAACGACCACAAGAGGAAGCAGAAAGTCCTAGGCCCCAACCAGAAACTGAAATTTAATCCAACAGAGTTAATTATTTATTGTAAAGATTTCAGAATTGTCAGATTTCGCTTTGATGAATCAGGTCCCGAAAGTGCTAAAAAGCAAACAAAATTAATGGAATTCCCTCAGGAGATGGAGGAGGAGGAGGAGGAGGAGGTAATGGAGCTGGTGGTGGCAGCAGCCAGAAAACTCCACTCTTTGAAACTTACTCGGATTGGGACAGAGAAATCAAGAGGACAGGTGCTTCCGGGTGGAGAGTTTGTTCTATTAACGAGGGTTACATGATATCCACTTGCCTTCCAGAATACATTGTAGTGCCAAGTTCTTTAGCAGACCAAGATCTAAAGATCTTTTCCCATTCTTTTGTTGGGAGAAGGATGCCACTCTGGTGCTGGAGCCACTCTAACGGCAGTGCTCTTGTGCGAATGGCCCTCATCAAAGACGTGCTGCAGCAGAGGAAGATTGACCAGAGGATTTGTAATGCAATAACTAAAAGTCACCCACAGAGAAGTGATGTTTACAAATCAGATTTGGATAAGACCTTGCCTAATATTCAAGAAGTACAGGCAGCATTTGTAAAACTGAAGCAGCTATGCGTTAATGAGCCTTTTGAAGAAACTGAAGAGAAATGGTTATCTTCACTGGAAAATACTCGATGGTTAGAATATGTAAGGGCATTCCTTAAGCATTCAGCAGAACTTGTATACATGCTAGAAAGCAAACATCTCTCTGTAGTCCTACAAGAGGAGGAAGGAAGAGACTTGAGCTGTTGTGTAGCTTCTCTTGTTCAAGTGATGCTGGATCCCTATTTTAGGACAATTACTGGATTTCAGAGTCTGATACAGAAGGAGTGGGTCATGGCAGGATATCAGTTTCTAGACAGATGCAACCATCTAAAGAGATCAGAGAAAGAGTCTCCTTTATTTTTGCTATTCTTGGATGCCACCTGGCAGCTGTTAGAACAATATCCTGCAGCTTTTGAGTTCTCCGAAACCTACCTGGCAGTGTTGTATGACAGCACCCGGATCTCACTGTTTGGCACCTTCCTGTTCAACTCCCCTCACCAGCGAGTGAAGCAAAGCACGGAATTTGCTATAAGCAAAAACATCCAATTGGGTGATGAGAAGGGCTTAAAATTCCCCTCTGTTTGGGACTGGTCTCTCCAGTTTACAGCAAAGGATCGCACCCTTTTCCATAACCCCTTCTACATTGGAAAGAGCACACCTTGTATACAGAATGGCTCCGTGAAGTCTTTTAAACGGACAAAGGTAAATCACAGCTAACAAAACGTGATGTTGGCTCACACGTAACCAAACACCTCTTTTTCAGAACAGAGAGCGTTAAAAGTAAAGGCACTTCCAAGAGTAACACTGCTAATGCGGGTTTCTGAGGGGTCATTCCCTTTTTAACTCAAATGACTGTATCCCAACTTTCTTCCTGGTGTCTGAGGCCCACAAAGTCTCAGTACCTGAGAGTGGGCAGATTGCAGCTTTGAGCCTGCAAGCCTGATTTACTAAAGCCCCATTTATCCATTTCTTGATGATTCAAGCCGCCACTGTGGCAGGGAATGCCGCCTGGCTGTGATGTAGTCATGGCCTCCTGACTGCTATATTCTTGTCCTAATAACATTCATTGTTTGCCTTTTTAATAATTCCCAAATAAATTCTTGGGATTTTTTTTGGTAGAAAATTTGCAGACTACTGAAAGGTACAGAACAAAGAATCAGACATTTGGCCTCCTGACTGCCTCTGTTCAGTTTGCCATTGTTCTTGATAGAATCGACCAGGTCTAGTGTTTTTTCTAGCCCGTCTTAGAACTTATCCTTAAGCAAATTAGTGGATAGGAGGTACTCTCATCCCGCCCCCATTCAGGCTGATAGTAACAGCCTAGGTAGAGTCAACACATAAAAAAGTGTAATTCCAGGGGAGGAGGATTAGAATAAGGACACAAAGGAAGGGAGGAAAATGTTCTTTGAGGCTGAAATTCCATTAATTTTTCATAGTATTGAGTTTATATTTGCCATTGCATCCTTCAATCTTTCTAAAAAGGGAATCCCCGGAACATAATAAAATCTCTTCTGTATAGAAAAGCTACAGCTCCACACTAAGAGGAATGCCGTCTGCCTTAAAGAATGGAATCATCAGTGACCAAGAATTACTTCCAAGGAGAAATTCATTGATATTAAAACCAAAGCCAGATCCAGCTCAGCAAACCGACAGCCAGAACAGTGATACGGAGCAGTATTTTAGAGAATGGTTTTCCAAACCCGCCAACCTGCACGGTGTTATTCTGCCACGTGTCTCTGGAACACACATAAAACTGTGGAAACTGTGCTACTTCCGCTGGGTTCCCGAGGCCCAGATCAGCCTGGGTGGCTCCATCACAGCCTTTCACAAGCTCTCCCTCCTGGCTGATGAAGTCGACGTACTGAGCAGGATGCTGCGGCAACAGCGCAGTGGCCCCCTGGAGGCCTGCTATGGGGAGCTGGGCCAGAGCAGGATGTACTTCAACGCCAGCGGCCCTCACCACACCGACACCTCGGGGACACCGGAGTTTCTCTCCTCCTCATTTCCATTTTCTCCTGTAGGGAATCTGTGCAGACGAAGCATTTTAGGAACACCATTAAGCAAATTTTTAAGTGGGGCCAAAATATGGTTGTCTACTGAGACATTAGCAAATGAAGACTAAAATAGGGTGTTTTCTGAACATTTTGAGGGAAGCTGTCAACTTTTTTCCTCTGAATTAACATTGCTAACCTAGGCGTTTGAATCTCTAATAACTTTATATGTAAGAATAATAGTTGGAATTTGCACTAATATTTAAAAACATGTTGAATCATGCTTCTTTCACACTTATTTTAAGAGAGATGTAAATTTTGTTCCTGTCCTCTTTCTGTCATTACAGGTCTGGCTCTTGTAACCGTGATCAAACTGTTCATGTTGTCTGCTACATTTTTGTCTCCATCCATTTTTCCTACCACCTCCTGAAGGCTATCTGATAGTCAGTCACATTAGCAGCCCCAGGCAGCAGACAACAGGAAAGTTAGGAAATTTGTGTTTCGTGTCATTTTTAGGAGCATCTGATAAAACCTCCAGCAGGTTTTAGGAAGTATTCATGTATTTTTCTGGTTACTTTCTGTCATCTCTAATTGAACTCACCTGATGAAGGTTCAGTGTTCTGGGGCCAGAATTTATGATTTTAGATCACCTTCTTTGGAACCTTAGATCACTGTGTTTTGAAATCATGAGTTTGCTTTTAACTTCATAGGGTCAACTTTAAAATGATATGCACTGTTAATTTTAAAGCATTTGCTGCAGATAATTAAACTTAGAAGTGCCTTTGACTTTAGGATACAAATATTACAGAAGAAAATATAATTTCACTTTTTAAAATTGGGGTGGGAAAATCCCATTGCATATTTGAAATAGGCTTTTCATACTAAGCTTCATAGCCAGAAGTCCCCAGAGTCTTGTTCCTCTGAAAGCCACTGGGGAGGGGCCTCTGGGGTGCTGATTCCACAGAGGTGTATGC TGTAGACAGGAGAGTGCCATCTATGCCAAAACTCGCCCTCAAAAACAAACAAGGCTTGCTGGGAGGCGTGCTGGGCTTGGCCATCAGTATTTCCAGTGTGGTAAACTATTGCTGGCACTTCCCCCTGGAAATAACTAATGAGGTTACGAGTTGGGCACCTGCACAGATGTCCTTCTCTCATAGTTCCTAATGCTTAGGAATAGAGGAGAAATAAAAAAATGGATTCTCTCAAAACACTGCCATTTGAATAGCGACAGAAGTGCTCCCCCAGCCCCCAACTTTGGACAGCAAAGTTGAGGAGAATGAGCAGACACAGTTGTTTTGCTTGATCTGAATCTCTCTAAAGTAAAGTATTTCCAAACTGTGTGACAAGAGCCTACCTACCACTGTAGCGGTCAAAGCTGAAGCTTCTTACAGCAGTGAAACGGGGCACCACCTCCCCCACACTCCTCATTCCCCGCTTAAAACATGGATACTTTCAAATTTGACTGTTTCTTAAACTGCCATCCTAAGATATGGAAAATTTTTATAGTAAAGTGTCTAGTTAGCTTATTTCCTTTTCTAAAACAAGTGTTTTCAAGATAACTGTATTTTACCTTTATATGTACTGAATAGCTGTTTCTTTTTGAATTATTTGCCTTTTAAAATTTGATAATGTCTCTGGATATAACAGGACAGGAGTTCTTAAAAAATATCTTAAGAAATTCACTTTATGGGTAAACCCAAGGTTTTTGCCAACTTGTTGCCTAGAAAATAAGGGCTAGTTTCAGTTTATACAAATAGAATTATTAAACATTTTACAGTCCTTGATTAGAAACCAGACCCAATCTCCTTATAACACCACAGCGTATCCTGCCATTGACAGTGTAATCACAATTCTCCCTTTTTCATTTAGCTGCTTTTTTATTATTACTAAATGTTTTGGATTGAGCATTTTTCCCTCTGTAATTTTCTTCCTTCACGTTTATTTTATTTTAACTCTTGTAGTATTTTATTGTTGTTAATTTACAAGTTTAAAAATATTAGGTACTATTAATAATGGTTAAAAATAGAAAAATGCATATTTTTGTATGATAATCAAATGTAAAATACTTTTATTTTTGCTGGACAGTTGTTATATCATGATTATTGTGCTACAGTTTATTGTGCATAATATGAAAAACAACTATGACAGCCTTCAGTCGGGCCAGGGTGAAGCTGCTTATACCACCTCTGCCGTCAGAGGGACATGTGGTGACAGCAGTGGTGTGGCTGCACAGGGCGCACTAGAGAGAGCTCAGCACCCCTGCTGCCCGCCAGCAGAGCCCGTGCTGAGGGAATGCCGCACAGATGCTGATGCACTGGGTGAAATTTCTAGTATTGAACGTAAAGGTGTACAGTGTCTTGCTGTTATTTTATGATGGAAACTGATTTTGAAACCAAAAATAGCTAACTAACTTTATTTAAGGAAAGGATATTAATTTGTACTAACAGAGGGTGAAAGCTGTTCACATTTGTCAACAAAATCTGCTTGCTGCAGTAGTAACCTCAAGTGGTTAAAACTTGATTTCCCGAGAAAACTAAAACCTTTGTGCCTAAAACTGATGACTTGAGTTCAAGTGGGATGAGCAAGAAGATGTGTTATCTTGTTGTTCAACAGTATTGAGTGTGAAGGAAATTTTGATGGCTTAATAAAATTCCACAGCAAAAAAAAAAAAAACTCTCCAGCGCTGGATCCGGCCATAAGGGCCTGATCCGTCGAGGGGGGGCCCGGTACCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTTCGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGCGCCCTGTAGCGGC

Vector Information:

Vector Name:pBluescriptR
Type:bacterial plasmid
Description:Phagemid cloning system T7 and T3 Promoters M13 forward and M13 reverse sequencing primers Ampicillin resistance in bacterial cultures
Properties:loxP
Comments:Modified pBluescript from Riken.
Map:pBluescriptR.gif
Sequence:pBluescriptR.txt
Size (bp):3178
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
MGC Consortium