Clone: HsCD00343158

Clone ID:HsCD00343158
Is Verified:Y
Status:AVAILABLE
Source:MGC
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

IMAGE ID 30337524
GI 47940449
GenBank Accession BC071586
Original Clone ID MGC:87301

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 3661 Homo sapiens CLOSED 7077 TIMP2 TIMP metallopeptidase inhibitor 2
Insert1
Size (bp)3661
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 7077
Gene SymbolTIMP2
Gene NameTIMP metallopeptidase inhibitor 2
Keyword

Insert Sequence:

AGCAAACACATCCGTAGAAGGCAGCGCGGCCGCCGAGAGCCGCAGCGCCGCTCGCCCGCCGCCCCCCACCCCGCCGCCCCGCCCGGCGAATTGCGCCCCGCGCCCCTCCCCTCGCGCCCCCGAGACAAAGAGGAGAGAAAGTTTGCGCGGCCGAGCGGGGCAGGTGAGGAGGGTGAGCCGCGCGGGAGGGGCCCGCCTCGGCCCCGGCTCAGCCCCCGCCCGCGCCCCCAGCCCGCCGCCGCGAGCAGCGCCCGGACCCCCCAGCGGCGGCCCCCGCCCGCCCAGCCCCCCGGCCCGCCATGGGCGCCGCGGCCCGCACCCTGCGGCTGGCGCTCGGCCTCCTGCTGCTGGCGACGCTGCTTCGCCCGGCCGACGCCTGCAGCTGCTCCCCGGTGCACCCGCAACAGGCGTTTTGCAATGCAGATGTAGTGATCAGGGCCAAAGCGGTCAGTGAGAAGGAAGTGGACTCTGGAAACGACATTTATGGCAACCCTATCAAGAGGATCCAGTATGAGATCAAGCAGATAAAGATGTTCAAAGGGCCTGAGAAGGATATAGAGTTTATCTACACGGCCCCCTCCTCGGCAGTGTGTGGGGTCTCGCTGGACGTTGGAGGAAAGAAGGAATATCTCATTGCAGGAAAGGCCGAGGGGGACGGCAAGATGCACATCACCCTCTGTGACTTCATCGTGCCCTGGGACACCCTGAGCACCACCCAGAAGAAGAGCCTGAACCACAGGTACCAGATGGGCTGCGAGTGCAAGATCACGCGCTGCCCCATGATCCCGTGCTACATCTCCTCCCCGGACGAGTGCCTCTGGATGGACTGGGTCACAGAGAAGAACATCAACGGGCACCAGGCCAAGTTCTTCGCCTGCATCAAGAGAAGTGACGGCTCCTGTGCGTGGTACCGCGGCGCGGCGCCCCCCAAGCAGGAGTTTCTCGACATCGAGGACCCATAAGCAGGCCTCCAACGCCCCTGTGGCCAACTGCAAAAAAAGCCTCCAAGGGTTTCGACTGGTCCAGCTCTGACATCCCTTCCTGGAAACAGCATGAATAAAACACTCATCCCATGGGTCCAAATTAATATGATTCTGCTCCCCCCTTCTCCTTTTAGACATGGTTGTGGGTCTGGAGGGAGACGTGGGTCCAAGGTCCTCATCCCATCCTCCCTCTGCCAGGCACTATGTGTCTGGGGCTTCGATCCTTGGGTGCAGGCAGGGCTGGGACACGCGGCTTCCCTCCCAGTCCCTGCCTTGGCACCGTCACAGATGCCAAGCAGGCAGCACTTAGGGATCTCCCAGCTGGGTTAGGGCAGGGCCTGGAAATGTGCATTTTGCAGAAACTTTTGAGGGTCGTTGCAAGACTGTGTAGCAGGCCTACCAGGTCCCTTTCATCTTGAGAGGGACATGGCCCTTGTTTTCTGCAGCTTCCACGCCTCTGCACTCCCTGCCCCTGGCAAGTGCTCCCATCGCCCCGGTGCCCACCATGAGCTCCCAGCACCTGACTCCCCCCACATCCAAGGGCAGCCTGGAACCAGTGGCTAGTTCTTGAAGGAGCCCCATCAATCCTATTAATCCTCAGAATTCCAGTGGGAGCCTCCCTCTGAGCCTTGTAGAAATGGGAGCGAGAAACCCCAGCTGAGCTGCGTTCCAGCCTCAGCTGAGTCTTTTTGGTCTGCACCCACCCCCCCACCCCCCCCCCGCCCACATGCTCCCCAGCTTGCAGGAGGAATCGGTGAGGTCCTGTCCTGAGGCTGCTGTCCGGGGCCGGTGGCTGCCCTCAAGGTCCCTTCCCTAGCTGCTGCGGTTGCCATTGCTTCTTGCCTGTTCTGGCATCAGGCACCTGGATTGAGTTGCACAGCTTTGCTTTATCCGGGCTTGTGTGCAGGGCCCGGCTGGGCTCCCCATCTGCACATCCTGAGGACAGAAAAAGCTGGGTCTTGCTGTGCCCTCCCAGGCTTAGTGTTCCCTCCCTCAAAGACTGACAGCCATCGTTCTGCACGGGGTTTTCTGCATGTGACGCCAGCTAAGCATAGTAAGAAGTCCAGCCTAGGAAGGGAAGGATTTTGGAGGTAGGTGGCTTTGGTGACACACTCACTTCTTTCTCAGCCTCCAGGACACTATGGCCTGTTTTAAGAGACATCTTATTTTTCTAAAGGTGAATTCTCAGATGATAGGTGAACCTGAGTTGCAGATATACCAACTTCTGCTTGTATTTCTTAAATGACAAAGATTACCTAGCTAAGAAACTTCCTAGGGAACTAGGGAACCTATGTGTTCCCTCAGTGTGGTTTCCTGAAGCCAGTGATATGGGGGTTAGGATAGGAAGAACTTTCTCGGTAATGATAAGGAGAATCTCTTGTTTCCTCCCACCTGTGTTGTAAAGATAAACTGACGATATACAGGCACATTATGTAAACATACACACGCAATGAAACCGAAGCTTGGCGGCCTGGGCGTGGTCTTGCAAAATGCTTCCAAAGCCACCTTAGCCTGTTCTATTCAGCGGCAACCCCAAAGCACCTGTTAAGACTCCTGACCCCCAAGTGGCATGCAGCCCCCATGCCCACCGGGACCTGGTCAGCACAGATCTTGATGACTTCCCTTTCTAGGGCAGACTGGGAGGGTATCCAGGAATCGGCCCCTGCCCCACGGGCGTTTTCATGCTGTACAGTGACCTAAAGTTGGTAAGATGTCATAATGGACCAGTCCATGTGATTTCAGTATATACAACTCCACCAGACCCCTCCAACCCATATAACACCCCACCCCTGTTCGCTTCCTGTATGGTGATATCATATGTAACATTTACTCCTGTTTCTGCTGATTGTTTTTTTAATGTTTTGGTTTGTTTTTGACATCAGCTGTAATCATTCCTGTGCTGTGTTTTTTATTACCCTTGGTAGGTATTAGACTTGCACTTTTTTAAAAAAAGGTTTCTGCATCGTGGAAGCATTTGACCCAGAGTGGAACGCGTGGCCTATGCAGGTGGATTCCTTCAGGTCTTTCCTTTGGTTCTTTGAGCATCTTTGCTTTCATTCGTCTCCCGTCTTTGGTTCTCCAGTTCAAATTATTGCAAAGTAAAGGATCTTTGAGTAGGTTCGGTCTGAAAGGTGTGGCCTTTATATTTGATCCACACACGTTGGTCTTTTAACCGTGCTGAGCAGAAAACAAAACAGGTTAAGAAGAGCCGGGTGGCAGCTGACAGAGGAAGCCGCTCAAATACCTTCACAATAAATAGTGGCAATATATATATAGTTTAAGAAGGCTCTCCATTTGGCATCGTTTAATTTATATGTTATGTTCTAAGCACAGCTCTCTTCTCCTATTTTCATCCTGCAAGCAACTCAAAATATTTAAAATAAAGTTTACATTGTAGTTATTTTCAAATCTTTGCTTGATAAGTATTAAGAAATATTGGACTTGCTGCCGTAATTTAAAGCTCTGTTGATTTTGTTTCCGTTTGGATTTTTGGGGGAGGGGAGCACTGTGTTTATGCTGGAATATGAAGTCTGAGACCTTCCGGTGCTGGGAACACACAAGAGTTGTTGAAAGTTGACAAGCAGACTGCGCATGTCTCTGATGCTTTGTATCATTCTTGAGCAATCGCTCGGTCCGTGGACAATAAACAGTATTATCAAAGAGAAAAAAAAAAAAAA

Insert Property: Insert 1

Type Value Extra Information
CDS Start 300
CDS Stop 962

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

GCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGAGCTCCACCGCGGTGGCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATGGATCAGGCCAAATCGGCCGAGCTCGAATTCGTCGAGAGCGGAGCAAACACATCCGTAGAAGGCAGCGCGGCCGCCGAGAGCCGCAGCGCCGCTCGCCCGCCGCCCCCCACCCCGCCGCCCCGCCCGGCGAATTGCGCCCCGCGCCCCTCCCCTCGCGCCCCCGAGACAAAGAGGAGAGAAAGTTTGCGCGGCCGAGCGGGGCAGGTGAGGAGGGTGAGCCGCGCGGGAGGGGCCCGCCTCGGCCCCGGCTCAGCCCCCGCCCGCGCCCCCAGCCCGCCGCCGCGAGCAGCGCCCGGACCCCCCAGCGGCGGCCCCCGCCCGCCCAGCCCCCCGGCCCGCCATGGGCGCCGCGGCCCGCACCCTGCGGCTGGCGCTCGGCCTCCTGCTGCTGGCGACGCTGCTTCGCCCGGCCGACGCCTGCAGCTGCTCCCCGGTGCACCCGCAACAGGCGTTTTGCAATGCAGATGTAGTGATCAGGGCCAAAGCGGTCAGTGAGAAGGAAGTGGACTCTGGAAACGACATTTATGGCAACCCTATCAAGAGGATCCAGTATGAGATCAAGCAGATAAAGATGTTCAAAGGGCCTGAGAAGGATATAGAGTTTATCTACACGGCCCCCTCCTCGGCAGTGTGTGGGGTCTCGCTGGACGTTGGAGGAAAGAAGGAATATCTCATTGCAGGAAAGGCCGAGGGGGACGGCAAGATGCACATCACCCTCTGTGACTTCATCGTGCCCTGGGACACCCTGAGCACCACCCAGAAGAAGAGCCTGAACCACAGGTACCAGATGGGCTGCGAGTGCAAGATCACGCGCTGCCCCATGATCCCGTGCTACATCTCCTCCCCGGACGAGTGCCTCTGGATGGACTGGGTCACAGAGAAGAACATCAACGGGCACCAGGCCAAGTTCTTCGCCTGCATCAAGAGAAGTGACGGCTCCTGTGCGTGGTACCGCGGCGCGGCGCCCCCCAAGCAGGAGTTTCTCGACATCGAGGACCCATAAGCAGGCCTCCAACGCCCCTGTGGCCAACTGCAAAAAAAGCCTCCAAGGGTTTCGACTGGTCCAGCTCTGACATCCCTTCCTGGAAACAGCATGAATAAAACACTCATCCCATGGGTCCAAATTAATATGATTCTGCTCCCCCCTTCTCCTTTTAGACATGGTTGTGGGTCTGGAGGGAGACGTGGGTCCAAGGTCCTCATCCCATCCTCCCTCTGCCAGGCACTATGTGTCTGGGGCTTCGATCCTTGGGTGCAGGCAGGGCTGGGACACGCGGCTTCCCTCCCAGTCCCTGCCTTGGCACCGTCACAGATGCCAAGCAGGCAGCACTTAGGGATCTCCCAGCTGGGTTAGGGCAGGGCCTGGAAATGTGCATTTTGCAGAAACTTTTGAGGGTCGTTGCAAGACTGTGTAGCAGGCCTACCAGGTCCCTTTCATCTTGAGAGGGACATGGCCCTTGTTTTCTGCAGCTTCCACGCCTCTGCACTCCCTGCCCCTGGCAAGTGCTCCCATCGCCCCGGTGCCCACCATGAGCTCCCAGCACCTGACTCCCCCCACATCCAAGGGCAGCCTGGAACCAGTGGCTAGTTCTTGAAGGAGCCCCATCAATCCTATTAATCCTCAGAATTCCAGTGGGAGCCTCCCTCTGAGCCTTGTAGAAATGGGAGCGAGAAACCCCAGCTGAGCTGCGTTCCAGCCTCAGCTGAGTCTTTTTGGTCTGCACCCACCCCCCCACCCCCCCCCCGCCCACATGCTCCCCAGCTTGCAGGAGGAATCGGTGAGGTCCTGTCCTGAGGCTGCTGTCCGGGGCCGGTGGCTGCCCTCAAGGTCCCTTCCCTAGCTGCTGCGGTTGCCATTGCTTCTTGCCTGTTCTGGCATCAGGCACCTGGATTGAGTTGCACAGCTTTGCTTTATCCGGGCTTGTGTGCAGGGCCCGGCTGGGCTCCCCATCTGCACATCCTGAGGACAGAAAAAGCTGGGTCTTGCTGTGCCCTCCCAGGCTTAGTGTTCCCTCCCTCAAAGACTGACAGCCATCGTTCTGCACGGGGTTTTCTGCATGTGACGCCAGCTAAGCATAGTAAGAAGTCCAGCCTAGGAAGGGAAGGATTTTGGAGGTAGGTGGCTTTGGTGACACACTCACTTCTTTCTCAGCCTCCAGGACACTATGGCCTGTTTTAAGAGACATCTTATTTTTCTAAAGGTGAATTCTCAGATGATAGGTGAACCTGAGTTGCAGATATACCAACTTCTGCTTGTATTTCTTAAATGACAAAGATTACCTAGCTAAGAAACTTCCTAGGGAACTAGGGAACCTATGTGTTCCCTCAGTGTGGTTTCCTGAAGCCAGTGATATGGGGGTTAGGATAGGAAGAACTTTCTCGGTAATGATAAGGAGAATCTCTTGTTTCCTCCCACCTGTGTTGTAAAGATAAACTGACGATATACAGGCACATTATGTAAACATACACACGCAATGAAACCGAAGCTTGGCGGCCTGGGCGTGGTCTTGCAAAATGCTTCCAAAGCCACCTTAGCCTGTTCTATTCAGCGGCAACCCCAAAGCACCTGTTAAGACTCCTGACCCCCAAGTGGCATGCAGCCCCCATGCCCACCGGGACCTGGTCAGCACAGATCTTGATGACTTCCCTTTCTAGGGCAGACTGGGAGGGTATCCAGGAATCGGCCCCTGCCCCACGGGCGTTTTCATGCTGTACAGTGACCTAAAGTTGGTAAGATGTCATAATGGACCAGTCCATGTGATTTCAGTATATACAACTCCACCAGACCCCTCCAACCCATATAACACCCCACCCCTGTTCGCTTCCTGTATGGTGATATCATATGTAACATTTACTCCTGTTTCTGCTGATTGTTTTTTTAATGTTTTGGTTTGTTTTTGACATCAGCTGTAATCATTCCTGTGCTGTGTTTTTTATTACCCTTGGTAGGTATTAGACTTGCACTTTTTTAAAAAAAGGTTTCTGCATCGTGGAAGCATTTGACCCAGAGTGGAACGCGTGGCCTATGCAGGTGGATTCCTTCAGGTCTTTCCTTTGGTTCTTTGAGCATCTTTGCTTTCATTCGTCTCCCGTCTTTGGTTCTCCAGTTCAAATTATTGCAAAGTAAAGGATCTTTGAGTAGGTTCGGTCTGAAAGGTGTGGCCTTTATATTTGATCCACACACGTTGGTCTTTTAACCGTGCTGAGCAGAAAACAAAACAGGTTAAGAAGAGCCGGGTGGCAGCTGACAGAGGAAGCCGCTCAAATACCTTCACAATAAATAGTGGCAATATATATATAGTTTAAGAAGGCTCTCCATTTGGCATCGTTTAATTTATATGTTATGTTCTAAGCACAGCTCTCTTCTCCTATTTTCATCCTGCAAGCAACTCAAAATATTTAAAATAAAGTTTACATTGTAGTTATTTTCAAATCTTTGCTTGATAAGTATTAAGAAATATTGGACTTGCTGCCGTAATTTAAAGCTCTGTTGATTTTGTTTCCGTTTGGATTTTTGGGGGAGGGGAGCACTGTGTTTATGCTGGAATATGAAGTCTGAGACCTTCCGGTGCTGGGAACACACAAGAGTTGTTGAAAGTTGACAAGCAGACTGCGCATGTCTCTGATGCTTTGTATCATTCTTGAGCAATCGCTCGGTCCGTGGACAATAAACAGTATTATCAAAGAGAAAAAAAAAAAAAACTCTCCAGCGCTGGATCCGGCCATAAGGGCCTGATCCGTCGAGGGGGGGCCCGGTACCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTTCGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGCGCCCTGTAGCGGC

Sequencing Information:

Phred Score: 693
Date: 2016-02-26

Last Passing Sequencing Read:

NGGGGGGATTCTAGGCGATTGGACTCCCCGCGGTGGCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATGGATCAGGCCAAATCGGCCGAGCTCGAATTCGTCGAGCTCTAGCGAGGTGACAGCGTAGAACCAGAGCAAACACATCCGTAGAAGGCAGCGCGGCCGCCGAGAGCCGCAGCGCCGCTCGCCCGCCGCCCCCCACCCCGCCGCCCCGCCCGGCGAATTGCGCCCCGCGCCCCTCCCCTCGCGCCCCCGAGACAAAGAGGAGAGAAAGTTTGCGCGGCCGAGCGGGGCAGGTGAGGAGGGTGAGCCGCGCGGGAGGGGCCCGCCTCGGCCCCGGCTCAGCCCCCGCCCGCGCCCCCAGCCCGCCGCCGCGAGCAGCGCCCGGACCCCCCAGCGGCGGCCCCCGCCCGCCCAGCCCCCCGGCCCGTCATGGGCGCCGCGGCCCGCACCCTGCGGCTGGCGCTCGGCCTCCTGCTGCTGGCGACGCTGCTTCGCCCGGCCGACGCCTGCAGCTGCTCCCCGGTGCACCCGCGACAGGCGTTTTGCCATGCAGATGTAGTGATCAGGGCCAAAGCGGTCAGTGAGAACGAAGTGGACTCTGGAAACGACATTTATGGCAACCCTATCAAGAGGATCCAGTATGAGATCAAGCAGATAAAGATGTTCACAGGGCCTGAGAAGGATATAGAGTTTATCTACACGGCCCCCTCCTCGGCAGTGTGTGGGGTCTCGCTGGACGTTGGAGGACAGAAGGAATATCTCATTGCAGGATAAGCCGAGGGGGACGGCAAGATGCACATCACCCTCTGTGACTTCTTCGTGCCCTGCGACACCCTGAGCACCACCCAAAGAAATAACCTGAACCACAGGTACCAGATGGGCTGCGAGTGCAAGATCACGCGCTGCCCCATGATTCCGTGCTACATCCTCCTCCCGGACGAGTGCCTCTGGATGGACTGCGGTCCCAGAAAAAAACTTCAACGGGCCCCAGGCTCAGTTCTTCGCCGGCTTCAAGATACTGACGGCTCCTGGGCGTGGTAACGGGGGCTCGGTCCCCCCAAAGCAGAATTCTTCCAATTGAGAACCAATACCGGGCTCCACCCCCTTGGGGCACCTGAAAAAAGCCCCCAAGGTTTAACGGGTCACCTCTACATCCTTCTGGAAAACAATAATAAAACCCTCCCTGGGTCCAAATATTAATCTCCCCCCTTCCTTTTACTTGTTGGGCCTGAGGAAAATGGCCAGGCCTTTCCCCCCCTGGCGGAAATGGTGTGGGTTACTTGGTGGAGGGGTGGACCGATTCCCCCTCGCCGTGGCCTCAAATAAGGGCCTATTGTCCCTGTGTTGGGGCCGAATCTTAAATTTTGGGCGAAGTGAAACCTTCTTCTGGAGGGCTTTTGTTCCCTCCCGTGAGGCCCGGGATACCGCCCCCGGGGAG

Vector Information:

Vector Name:pBluescriptR
Type:bacterial plasmid
Description:Phagemid cloning system T7 and T3 Promoters M13 forward and M13 reverse sequencing primers Ampicillin resistance in bacterial cultures
Properties:loxP
Comments:Modified pBluescript from Riken.
Map:pBluescriptR.gif
Sequence:pBluescriptR.txt
Size (bp):3178
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
MGC Consortium