Clone: HsCD00342883

Clone ID:HsCD00342883
Is Verified:Y
Status:AVAILABLE
Source:MGC
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

IMAGE ID 9021742
GenBank Accession BC140874
Original Clone ID MGC:176551
GI 187954992

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 3872 Homo sapiens CLOSED 10495 ENOX2 ecto-NOX disulfide-thiol exchanger 2
Insert1
Size (bp)3872
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 10495
Gene SymbolENOX2
Gene Nameecto-NOX disulfide-thiol exchanger 2
Keyword

Insert Sequence:

TTGAACCAGCTGCCCTTTGACCCTGCTAACAACAACGAGCCCCTGCAGTTTGGTAGTGCCAGTGGCCCTCTGGTCACAGAAGGCCTCATTGAGAATGGAGGGGAATCAAGCAAGAAAAGAAAGAGAACAAATACTCCTTCAGAAATGATGACAGAGCTAAGTTCACAGTTGAGGACCACACAATGCAAAGAGATTTTAGATGGCTGTGGGTCTACGAAATAGGCTATGCAGCCGATAACAGTAGAACTCTGAACGTGGATTCCACTGCAATGACACTACCTATGTCTGATCCAACTGCATGGGCCACAGCAATGAATAATCTTGGAATGGCACCGCTGGGAATTGCCGGACAACCAATTTTACCTGACTTTGATCCTGCTCTTGGAATGATGACTGGAATTCCACCAATAACTCCAATGATGCCTGGTTTGGGAATAGTACCTCCACCAATTCCTCCAGATATGCCAGTAGTAAAAGAGATCATACACTGTAAAAGCTGCACGCTCTTCCCTCCAAATCCAAATCTCCCACCTCCTGCAACCCGAGAAAGACCACCAGGATGCAAAACAGTATTTGTGGGTGGTCTGCCTGAAAATGGGACAGAGCAAATCATTGTGGAAGTTTTCGAGCAGTGTGGAGAGATCATTGCCATTCGCAAGAGCAAGAAGAACTTCTGCCACATTCGCTTTGCTGAGGAGTACATGGTGGACAAAGCCCTGTATCTGTCTGGTTACCGCATTCGCCTGGGCTCTAGTACTGACAAGAAGGACACAGGCAGACTCCACGTTGATTTCGCACAGGCTCGAGATGACCTGTATGAGTGGGAGTGTAAACAGCGTATGCTAGCCAGAGAGGAGCGCCATCGTAGAAGAATGGAAGAAGAAAGATTGCGTCCACCATCTCCACCCCCAGTGGTCCACTATTCAGATCATGAATGCAGCATTGTTGCTGAAAAATTAAAAGATGATTCCAAATTCTCAGAAGCTGTACAGACCTTGCTTACCTGGATAGAGCGAGGAGAGGTCAACCGTCGTAGCGCCAATAACTTCTACTCCATGATCCAGTCGGCCAACAGCCATGTCCGCCGCCTGGTGAACGAGAAAGCTGCCCATGAGAAAGATATGGAAGAAGCAAAGGAGAAGTTCAAGCAGGCCCTTTCTGGAATTCTCATTCAATTTGAGCAGATAGTGGCTGTGTACCATTCCGCCTCCAAGCAGAAGGCATGGGACCACTTCACAAAAGCCCAGCGGAAGAACATCAGCGTGTGGTGCAAACAAGCTGAGGAAATTCGCAACATTCATAATGATGAATTAATGGGAATCAGGCGAGAAGAAGAAATGGAAATGTCTGATGATGAAATAGAAGAAATGACAGAAACAAAAGAAACTGAGGAATCAGCCTTAGTATCACAGGCAGAAGCTCTGAAGGAAGAAAATGACAGCCTCCGTTGGCAGCTCGATGCCTACCGGAATGAAGTAGAACTGCTCAAGCAAGAACAAGGCAAAGTCCACAGAGAAGATGACCCTAACAAAGAACAGCAGCTGAAACTCCTGCAACAAGCCCTGCAAGGAATGCAACAGCATCTACTCAAAGTCCAAGAGGAATACAAAAAGAAAGAAGCTGAACTTGAAAAACTCAAAGATGACAAGTTACAGGTGGAAAAAATGTTGGAAAATCTTAAAGAAAAGGAAAGCTGTGCTTCTAGGCTGTGTGCCTCAAACCAGGATAGCGAATACCCTCTTGAGAAGACCATGAACAGCAGTCCTATCAAATCTGAACGTGAAGCACTGCTAGTGGGGATTATCTCCACATTCCTTCATGTTCACCCATTTGGAGCAAGCATTGAATACATCTGTTCCTACTTGCACCGTCTTGATAATAAGATCTGCACCAGCGATGTGGAGTGTCTCATGGGTAGACTCCAGCATACCTTCAAGCAGGAAATGACTGGAGTTGGAGCCAGCCTGGAAAAGAGATGGAAATTCTGTGGCTTCGAGGGCTTGAAGCTGACCTAAATCTCTTTGCCTAACAACTTGGGATCCTGAAGATAAATATGTGTTGGACAAGCATAGAAAGTGATTTATATTTTTAATGGTTTTCAAGTGGAAGTTCCTTTGAATTTGTCAGTTCATTCCTGGAAAATCTTTTGAGTTAAAATAAGGATCCTAGGACAGCACCTCGAACTACAGGCCCTAAAGAGAAATTGCCTCAAACCACAAGTGCTGTAACTTCCTCCCCTTTCTGTCAATTGGTTGTCTTTAAATATTGCAAAAGTCCTGATGCTAAACAGTATTTGGAGTGTTTTCAGTGTCTGTACTACTGTTGTAGACCTTGGTATTTTTTTAAACACTGTTAACTGAAATGTTTTGATGATTTGTATGTGATTTGTGTTTCTAAACTTCTCTTTACATTAATGTTGTTACTGGTGAAAGGCATGAGAGCAGCACTAAGTCCTCTGTGTAACTGCCATTGTCTTTCCAATCCCCAGTAGACCAGTAAATAAATAACACATCAGTGTCTTCTAGAAGGTGCCTGACCAGGTTCACCTTTTAAACGACAAAGCATGGTTTGTGGCTTTTTGCAAAATTACTATGAACCAAAAGTTGACAAATGTTCCAAAGTTATTTTCTCTAACATATCACATTAAAGATCTGTTTCAGAATTGTAAAAAGTACATCTAGATGTGTTTACAGAAAGCAAGTATCCAGTATGACTGGCATGTGTTCATGCTATTCAGAATCACTTGTAAATAGTCTGCTTTTAAAGGAGGGCATGTTCAGTTTTCTGTGAATTAAAATATGCTCATGTGTGGGCACACACGCACAAACACACACACGCACGCACACAGTGGCAGAAGGGATTTATATTAATATTCTTTCCCCTCTGGCCTTCTTACAGTCTGTTGGTCCCTTTGCTTCTGTTGTCAGTGTGTTGAATTGCAAACCGAGTACTGCTGTAAATACTATGTTTACTTCATGCTGAATGTTTGCAAAGACTTGATATAAGTATTAATAGTAATGAATCAATGAATAAATAATGAGCTAGGGTTTGTGAGGCTTTCTACAAATAGGTCAGCTCCACCTGGAGTGCGAATTGCCAGAGACACCTTGGTAGTGCCCATCGGCAAATCGCAATGGCAGCATGTGAGTGGACCATTCAGAAACTTCTGCTTGGTGGAAAGTAAACAGAGAGGATGGAGGTTTGGGGCGAATGTCCTGAGGCAGAGATGGTCTTTATTGTGTGTGGTGGTGGTTGTGGTATTTATAATAATGCAAGCATACCCTCCCTTGAGTCTCAATTGAAGATAAAAGAATGTACTGAGCAAGCAAAGCCAATGGAGAGTATTTCACAAAAATACTTTGTAAATGAGATGCCAGTAGTGTTCAAAGTTGTATTTTTAAAAGATAAATATTCCTTTTTATACCTCAGTTTTGTGTCCTGTTTTTAATGACTTACGCTCTAAGTAATCCATTAGTAGTTATCTCAGTTCCTTCCTTTGGGTTACTAGAATGTTGGAAAAAGATGCCAAGTCTGTCTTGACAACTGGAAACAGGGTTCCACAGCAGCCCATTCGTGCTGAAAACTGGCTTCCCCCTGAAGCACCCTGCTGTGGCACCAGCAGGAAGCTCAGGTTAATTTTACACTAGCTTGCTCACTGATGCATCTCTCATCAATGCTACGGAAGGCTTTGATTCATCAGTCTCGGGCTCTTGGAATACCTAATTTTAATAATATCTATGAAATCAAGGGAAACTTTCCATTTACAGTTATTTCTTGTTTAAATAAACTAAATTAATTTTTAGGGGAGAGCAGTAGGAAAAAGAGCTAATGCATGCGGGGTTTAATACCTAGGTGATGGGTTGAGGTGCAGC

Insert Property: Insert 1

Type Value Extra Information
CDS Start 183
CDS Stop 2015

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

AGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTCAGAATTAACCCTCACTAAAGGGACTAGTCCTGCAGGTTTAAACGAATTCGCCCTTTTGAACCAGCTGCCCTTTGACCCTGCTAACAACAACGAGCCCCTGCAGTTTGGTAGTGCCAGTGGCCCTCTGGTCACAGAAGGCCTCATTGAGAATGGAGGGGAATCAAGCAAGAAAAGAAAGAGAACAAATACTCCTTCAGAAATGATGACAGAGCTAAGTTCACAGTTGAGGACCACACAATGCAAAGAGATTTTAGATGGCTGTGGGTCTACGAAATAGGCTATGCAGCCGATAACAGTAGAACTCTGAACGTGGATTCCACTGCAATGACACTACCTATGTCTGATCCAACTGCATGGGCCACAGCAATGAATAATCTTGGAATGGCACCGCTGGGAATTGCCGGACAACCAATTTTACCTGACTTTGATCCTGCTCTTGGAATGATGACTGGAATTCCACCAATAACTCCAATGATGCCTGGTTTGGGAATAGTACCTCCACCAATTCCTCCAGATATGCCAGTAGTAAAAGAGATCATACACTGTAAAAGCTGCACGCTCTTCCCTCCAAATCCAAATCTCCCACCTCCTGCAACCCGAGAAAGACCACCAGGATGCAAAACAGTATTTGTGGGTGGTCTGCCTGAAAATGGGACAGAGCAAATCATTGTGGAAGTTTTCGAGCAGTGTGGAGAGATCATTGCCATTCGCAAGAGCAAGAAGAACTTCTGCCACATTCGCTTTGCTGAGGAGTACATGGTGGACAAAGCCCTGTATCTGTCTGGTTACCGCATTCGCCTGGGCTCTAGTACTGACAAGAAGGACACAGGCAGACTCCACGTTGATTTCGCACAGGCTCGAGATGACCTGTATGAGTGGGAGTGTAAACAGCGTATGCTAGCCAGAGAGGAGCGCCATCGTAGAAGAATGGAAGAAGAAAGATTGCGTCCACCATCTCCACCCCCAGTGGTCCACTATTCAGATCATGAATGCAGCATTGTTGCTGAAAAATTAAAAGATGATTCCAAATTCTCAGAAGCTGTACAGACCTTGCTTACCTGGATAGAGCGAGGAGAGGTCAACCGTCGTAGCGCCAATAACTTCTACTCCATGATCCAGTCGGCCAACAGCCATGTCCGCCGCCTGGTGAACGAGAAAGCTGCCCATGAGAAAGATATGGAAGAAGCAAAGGAGAAGTTCAAGCAGGCCCTTTCTGGAATTCTCATTCAATTTGAGCAGATAGTGGCTGTGTACCATTCCGCCTCCAAGCAGAAGGCATGGGACCACTTCACAAAAGCCCAGCGGAAGAACATCAGCGTGTGGTGCAAACAAGCTGAGGAAATTCGCAACATTCATAATGATGAATTAATGGGAATCAGGCGAGAAGAAGAAATGGAAATGTCTGATGATGAAATAGAAGAAATGACAGAAACAAAAGAAACTGAGGAATCAGCCTTAGTATCACAGGCAGAAGCTCTGAAGGAAGAAAATGACAGCCTCCGTTGGCAGCTCGATGCCTACCGGAATGAAGTAGAACTGCTCAAGCAAGAACAAGGCAAAGTCCACAGAGAAGATGACCCTAACAAAGAACAGCAGCTGAAACTCCTGCAACAAGCCCTGCAAGGAATGCAACAGCATCTACTCAAAGTCCAAGAGGAATACAAAAAGAAAGAAGCTGAACTTGAAAAACTCAAAGATGACAAGTTACAGGTGGAAAAAATGTTGGAAAATCTTAAAGAAAAGGAAAGCTGTGCTTCTAGGCTGTGTGCCTCAAACCAGGATAGCGAATACCCTCTTGAGAAGACCATGAACAGCAGTCCTATCAAATCTGAACGTGAAGCACTGCTAGTGGGGATTATCTCCACATTCCTTCATGTTCACCCATTTGGAGCAAGCATTGAATACATCTGTTCCTACTTGCACCGTCTTGATAATAAGATCTGCACCAGCGATGTGGAGTGTCTCATGGGTAGACTCCAGCATACCTTCAAGCAGGAAATGACTGGAGTTGGAGCCAGCCTGGAAAAGAGATGGAAATTCTGTGGCTTCGAGGGCTTGAAGCTGACCTAAATCTCTTTGCCTAACAACTTGGGATCCTGAAGATAAATATGTGTTGGACAAGCATAGAAAGTGATTTATATTTTTAATGGTTTTCAAGTGGAAGTTCCTTTGAATTTGTCAGTTCATTCCTGGAAAATCTTTTGAGTTAAAATAAGGATCCTAGGACAGCACCTCGAACTACAGGCCCTAAAGAGAAATTGCCTCAAACCACAAGTGCTGTAACTTCCTCCCCTTTCTGTCAATTGGTTGTCTTTAAATATTGCAAAAGTCCTGATGCTAAACAGTATTTGGAGTGTTTTCAGTGTCTGTACTACTGTTGTAGACCTTGGTATTTTTTTAAACACTGTTAACTGAAATGTTTTGATGATTTGTATGTGATTTGTGTTTCTAAACTTCTCTTTACATTAATGTTGTTACTGGTGAAAGGCATGAGAGCAGCACTAAGTCCTCTGTGTAACTGCCATTGTCTTTCCAATCCCCAGTAGACCAGTAAATAAATAACACATCAGTGTCTTCTAGAAGGTGCCTGACCAGGTTCACCTTTTAAACGACAAAGCATGGTTTGTGGCTTTTTGCAAAATTACTATGAACCAAAAGTTGACAAATGTTCCAAAGTTATTTTCTCTAACATATCACATTAAAGATCTGTTTCAGAATTGTAAAAAGTACATCTAGATGTGTTTACAGAAAGCAAGTATCCAGTATGACTGGCATGTGTTCATGCTATTCAGAATCACTTGTAAATAGTCTGCTTTTAAAGGAGGGCATGTTCAGTTTTCTGTGAATTAAAATATGCTCATGTGTGGGCACACACGCACAAACACACACACGCACGCACACAGTGGCAGAAGGGATTTATATTAATATTCTTTCCCCTCTGGCCTTCTTACAGTCTGTTGGTCCCTTTGCTTCTGTTGTCAGTGTGTTGAATTGCAAACCGAGTACTGCTGTAAATACTATGTTTACTTCATGCTGAATGTTTGCAAAGACTTGATATAAGTATTAATAGTAATGAATCAATGAATAAATAATGAGCTAGGGTTTGTGAGGCTTTCTACAAATAGGTCAGCTCCACCTGGAGTGCGAATTGCCAGAGACACCTTGGTAGTGCCCATCGGCAAATCGCAATGGCAGCATGTGAGTGGACCATTCAGAAACTTCTGCTTGGTGGAAAGTAAACAGAGAGGATGGAGGTTTGGGGCGAATGTCCTGAGGCAGAGATGGTCTTTATTGTGTGTGGTGGTGGTTGTGGTATTTATAATAATGCAAGCATACCCTCCCTTGAGTCTCAATTGAAGATAAAAGAATGTACTGAGCAAGCAAAGCCAATGGAGAGTATTTCACAAAAATACTTTGTAAATGAGATGCCAGTAGTGTTCAAAGTTGTATTTTTAAAAGATAAATATTCCTTTTTATACCTCAGTTTTGTGTCCTGTTTTTAATGACTTACGCTCTAAGTAATCCATTAGTAGTTATCTCAGTTCCTTCCTTTGGGTTACTAGAATGTTGGAAAAAGATGCCAAGTCTGTCTTGACAACTGGAAACAGGGTTCCACAGCAGCCCATTCGTGCTGAAAACTGGCTTCCCCCTGAAGCACCCTGCTGTGGCACCAGCAGGAAGCTCAGGTTAATTTTACACTAGCTTGCTCACTGATGCATCTCTCATCAATGCTACGGAAGGCTTTGATTCATCAGTCTCGGGCTCTTGGAATACCTAATTTTAATAATATCTATGAAATCAAGGGAAACTTTCCATTTACAGTTATTTCTTGTTTAAATAAACTAAATTAATTTTTAGGGGAGAGCAGTAGGAAAAAGAGCTAATGCATGCGGGGTTTAATACCTAGGTGATGGGTTGAGGTGCAGCAGTTCGAGAAGGGCGAATTCGCGGCCGCTAAATTCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTATACGTACGGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATGTACAGAGTGATATTATTGACACGCCGGGGCGACGGATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCTCCCGTGAACTTTACCCGGTGGTGCATATCGGGGATGAAAGCTGGCGCATGATGACCACCGATATGGCCAGTGTGCCGGTCTCCGTTATCGGGGAAGAAGTGGCTGATCTCAGCCACCGCGAAAATGACATCAAAAACGCCATTAACCTGATGTTCTGGGGAATATAAATGTCAGGCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTCACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGGATGAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGCAGGTAGCTTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGCTCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAAGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGAGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAATTATTAACGCTTACAATTTCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAA

Vector Information:

Vector Name:pCR4-TOPO
Type:bacterial plasmid
Description:TOPO Cloning vector with ampicillin resistance in bacteria.
Properties:TOPO Cloning
Comments:
Map:pCR4TopoTA.bmp
Sequence:CR4Topo.txt
Size (bp):3956
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
MGC Consortium