Clone: HsCD00342221

Clone ID:HsCD00342221
Is Verified:Y
Status:AVAILABLE
Source:MGC
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

Original Clone ID MGC:168229
IMAGE ID 9020606
GI 187953292
GenBank Accession BC136616

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 4109 Homo sapiens CLOSED 57589 KIAA1432 KIAA1432
Insert1
Size (bp)4109
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 57589
Gene SymbolKIAA1432
Gene NameKIAA1432
Keyword

Insert Sequence:

TGAATGGAGGCCAGATAGTACCATGATAGCTGTATCAACGGCAAATGGATACATCTTGTTTTTTCATATTACATCTACAAGAGGGGACAAGTACCTTTATGAACCAGTGTATCCCAAAGGAAGTCCACAAATGAAGGGGACACCCCATTTTAAGGAAGAACAGTGTGCTCCAGCATTAAATTTGGAGATGAGGAAAATACTGGATTTACAAGCACCCATCATGAGTTTGCAGTCTGTGTTGGAAGATCTCCTGGTTGCTACTTCTGATGGACTTCTTCATCTTATTCACTGGGAAGGAATGACAAATGGAAGGAAAGCCATTAATCTTTGCACAGTACCCTTTTCAGTAGACCTGCAGTCATCTAGAGTAGGTTCATTCCTGGGCTTCACAGACGTACACATCAGAGACATGGAATACTGTGCCACACTTGATGGGTTTGCTGTTGTATTTAATGATGGTAAAGTTGGATTTATTACACCAGTGTCAAGTAGATTTACTGCAGAGCAGCTTCATGGAGTTTGGCCACAAGATGTTGTTGACGGAACGTGTGTAGCAGTAAATAACAAGTATCGACTAATGGCATTTGGCTGTGTGAGTGGTTCTGTGCAGGTCTATACAATAGATAACAGCACTGGAGCCATGCTGCTATCTCATAAATTAGAGCTAACAGCAAAACAGTATCCTGACATTTGGAATAAAACAGGAGCTGTTAAATTGATGAGATGGTCTCCTGACAATAGTGTTGTAATAGTGACCTGGGAATACGGAGGCCTTTCTTTATGGAGTGTTTTTGGAGCACAGCTGATTTGTACACTTGGAGGAGATTTTGCTTATAGGTCTGATGGCACCAAAAAAGATCCCCTTAAGATCAACTCTATGAGCTGGGGTGCAGAAGGCTATCACCTATGGGTAATCAGCGGATTTGGTTCTCAAAACACTGAAATTGAGTCTGACCTCAGGAGTGTAGTTAAACAGCCCAGCATCCTGTTATTTCAGTTTATTAAGAGTGTACTCACTGTAAACCCTTGTATGAGTAACCAAGAGCAGGTGTTGCTTCAGGGTGAGGATCGCTTGTACTTGAACTGTGGAGAGGCTTCACAAACCCAGAATCCCAGGAGTTCTTCAACACACTCTGAGCATAAGCCCAGTCGAGAAAAGAGCCCATTTGCAGATGGAGGTTTAGAGTCTCAGGGATTAAGCACTTTACTTGGACATCGGCATTGGCATGTTGTACAGATTTCCAGCACCTATCTAGAGAGCAATTGGCCTATACGGTTTTCAGCTATTGATAAGCTTGGACAGAATATTGCTGTGGTTGGCAAGTTTGGTTTTGCACATTACTCTTTACTCACCAAAAAATGGAAACTTTTTGGAAACATTACCCAGGAGCAAAATATGATCGTGACAGGTGGCTTAGCCTGGTGGAATGATTTTATGGTCCTTGCGTGTTATAACATAAATGACCGTCAAGAAGAGCTTAGAGTATACTTGCGAACATCAAATCTGGACAATGCCTTTGCTCATGTCACCAAAGCACAAGCAGAAACATTACTGCTTAGTGTCTTCCAGGACATGGTAATAGTATTTAGAGCAGACTGTTCAATATGCCTTTACAGTATTGAAAGAAAATCTGATGGTCCAAATACTACTGCTGGTATTCAAGTTCTTCAGGAGGTTTCCATGTCACGCTACATTCCTCACCCTTTCCTGGTGGTATCTGTCACTCTGACATCAGTGAGTACAGAGAATGGAATCACCTTGAAAATGCCACAGCAGGCTCGTGGTGCAGAGAGCATTATGTTAAACCTGGCAGGACAGCTCATCATGATGCAGAGGGACAGGTCAGGCCCACAGATCCGGGAGAAGGACAGTAACCCTAATAACCAAAGGAAACTTCTGCCATTCTGTCCTCCTGTTGTACTAGCCCAGTCTGTTGAAAATGTCTGGACAACGTGTCGAGCAAATAAACAGAAACGTCACCTTCTGGAGGCCCTCTGGCTGAGCTGTGGTGGTGCAGGGATGAAAGTTTGGCTCCCTCTCTTCCCTAGGGATCACCGCAAGCCCCATTCCTTCTTGTCCCAGCGGATCATGCTGCCTTTCCACATCAACATTTACCCGCTAGCTGTTCTGTTTGAAGATGCTTTAGTCCTTGGTGCTGTCAATGACACTTTGCTCTATGATTCTTTATATACTCGGAACAATGCTAGAGAACAGCTGGAGGTGCTCTTCCCTTTCTGTGTTGTGGAGAGAACCTCTCAGATCTACCTCCACCACATTCTACGTCAACTTCTGGTCAGAAACCTTGGGGAGCAAGCCTTGCTCTTGGCCCAGTCCTGTGCCACATTACCTTACTTCCCTCATGTGCTGGAGCTCATGCTCCATGAAGTACTGGAAGAAGAAGCTACCTCACGGGAGCCCATTCCCGACCCTCTGCTTCCCACTGTGGCAAAATTTATCACTGAGTTCCCCCTCTTCCTGCAGACAGTTGTCCATTGTGCCAGGAAGACCGAATATGCCCTGTGGAATTACCTTTTTGCAGCTGTTGGAAACCCTAAGGACTTGTTTGAGGAGTGTTTGATGGCTCAGGATTTGGACACAGCTGCCTCTTACCTTATTATCTTACAGAATATGGAAGTCCCTGCAGTAAGTAGGCAACATGCTACCCTTCTATTCAACACAGCACTAGAACAAGGCAAGTGGGACCTTTGTCGACACATGATTCGATTTCTTAAAGCCATTGGCTCTGGAGAATCTGAGACACCTCCATCCACACCCACAGCTCAGGAACCCAGTTCAAGTGGTGGATTTGAGTTCTTCAGGAATCGAAGCATCAGTTTATCCCAGTCAGCTGAAAATGTTCCTGCCAGTAAATTCAGTTTACAGAAAACACTAAGTATGCCATCTGGTCCCTCTGGAAAAAGATGGAGCAAAGACAGTGACTGTGCTGAGAACATGTATATTGACATGATGCTCTGGAGACATGCTCGGCGCCTCTTAGAAGATGTGAGGTTAAAGGACCTTGGCTGCTTTGCAGCCCAGCTGGGCTTTGAACTAATTAGTTGGCTATGCAAGGAACGTACCCGAGCCGCCCGGGTAGACAACTTTGTAATAGCCCTGAAGAGACTCCACAAAGATTTCCTGTGGCCACTTCCAATCATCCCAGCCTCTTCTATCAGTTCTCCTTTCAAAAATGGAAAATACCGAACTGTGGGAGAGCAGCTGTTAAAGTCTCAATCAGCTGACCCATTTTTGAACCTTGAGATGGATGCTGGCATCTCCAACATCCAGCGAAGTCAGAGCTGGCTCAGCAACATTGGCCCCACCCATCATGAGATAGACACAGCTTCATCCCATGGACCACAAATGCAAGATGCCTTCTTGTCACCTTTATCTAATAAAGGTGATGAATGCAGTATTGGTTCAGCCACAGACTTGACTGAAAGTAGCTCCATGGTGGATGGCGACTGGACAATGGTGGATGAAAATTTCTCTACACTCAGTTTAACTCAGTCAGAGCTGGAGCACATTTCCATGGAGTTGGCCAGTAAAGGGCCTCATAAATCCCAGGTCCAGCTTCGGTATTTGCTACACATTTTCATGGAGGCAGGGTGCCTAGACTGGTGCATCGTTATAGGCCTGATTCTTAGAGAATCCTCAATAATCAATCAGATTTTGGTTATTACACAGTCTTCAGAGGTAGATGGAGAGATGTTACAGAACATAAAGACAGGGCTCCATGCAGTGGACCGATGGGCCTCTACAGACTGTCCTGGATATAAGCCATTTTTAAACATCATTAAGCCACAACTGCAGAAGCTCAGTGAGATAACAGAAGAGCAGGTCCAGCCAGATGCCTTCCAACCAATAACTATGGGTAAGACTCCAGAACAGACTAGCCCCCGGGCAGAGGAGAGCAGGGGCTCCTCCAGCCATGGAAGCATCCCCCAGGGTGAAGTTGGAAGCAGCAATATGGTCAGCCGGAAAGAGGAGGACACAGCC CAAGCAGAGGAGGAAGAACCTTTTCAGGATGGGACTTACGACTGTTCTGTGTCCTAACAGTGAGGTTCCATCACAAAGGGGCAGTATTAATTAGCAGCAGCGTGCAGCT

Insert Property: Insert 1

Type Value Extra Information
CDS Start 23
CDS Stop 4057

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAGCACGTGTCAGTCCTGCTCCTCGGCCACGAAGTGCACGCAGTTGCCGGCCGGGTCGCGCAGGGCGAACTCCCGCCCCCACGGCTGCTCGCCGATCTCGGTCATGGCCGGCCCGGAGGCGTCCCGGAAGTTCGTGGACACGACCTCCGACCACTCGGCGTACAGCTCGTCCAGGCCGCGCACCCACACCCAGGCCAGGGTGTTGTCCGGCACCACCTGGTCCTGGACCGCGCTGATGAACAGGGTCACGTCGTCCCGGACCACACCGGCGAAGTCGTCCTCCACGAAGTCCCGGGAGAACCCGAGCCGGTCGGTCCAGAACTCGACCGCTCCGGCGACGTCGCGCGCGGTGAGCACCGGAACGGCACTGGTCAACTTGGCCATGGTGGCCCTCCTCACGTGCTATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGTATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGAAATTGTAAGCGTTAATAATTCAGAAGAACTCGTCAAGAAGGCGATAGAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGTCAGCCCATTCGCCGCCAAGCTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCTGATAGCGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTTCCACCATGATATTCGGCAAGCAGGCATCGCCATGGGTCACGACGAGATCCTCGCCGTCGGGCATGCTCGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATGCTCTTCGTCCAGATCATCCTGATCGACAAGACCGGCTTCCATCCGAGTACGTGCTCGCTCGATGCGATGTTTCGCTTGGTGGTCGAATGGGCAGGTAGCCGGATCAAGCGTATGCAGCCGCCGCATTGCATCAGCCATGATGGATACTTTCTCGGCAGGAGCAAGGTGAGATGACAGGAGATCCTGCCCCGGCACTTCGCCCAATAGCAGCCAGTCCCTTCCCGCTTCAGTGACAACGTCGAGCACAGCTGCGCAAGGAACGCCCGTCGTGGCCAGCCACGATAGCCGCGCTGCCTCGTCTTGCAGTTCATTCAGGGCACCGGACAGGTCGGTCTTGACAAAAAGAACCGGGCGCCCCTGCGCTGACAGCCGGAACACGGCGGCATCAGAGCAGCCGATTGTCTGTTGTGCCCAGTCATAGCCGAATAGCCTCTCCACCCAAGCGGCCGGAGAACCTGCGTGCAATCCATCTTGTTCAATCATGCGAAACGATCCTCATCCTGTCTCTTGATCAGAGCTTGATCCCCTGCGCCATCAGATCCTTGGCGGCGAGAAAGCCATCCAGTTTACTTTGCAGGGCTTCCCAACCTTACCAGAGGGCGCCCCAGCTGGCAATTCCGGTTCGCTTGCTGTCCATAAAACCGCCCAGTCTAGCTATCGCCATGTAAGCCCACTGCAAGCTACCTGCTTTCTCTTTGCGCTTGCGTTTTCCCTTGTCCAGATAGCCCAGTAGCTGACATTCATCCGGGGTCAGCACCGTTTCTGCGGACTGGCTTTCTACGTGAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGCCTGACATTTATATTCCCCAGAACATCAGGTTAATGGCGTTTTTGATGTCATTTTCGCGGTGGCTGAGATCAGCCACTTCTTCCCCGATAACGGAGACCGGCACACTGGCCATATCGGTGGTCATCATGCGCCAGCTTTCATCCCCGATATGCACCACCGGGTAAAGTTCACGGGAGACTTTATCTGACAGCAGACGTGCACTGGCCAGGGGGATCACCATCCGTCGCCCCGGCGTGTCAATAATATCACTCTGTACATCCACAAACAGACGATAACGGCTCTCTCTTTTATAGGTGTAAACCTTAAACTGCCGTACGTATAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGGCCCTCTAGATGCATGCTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCGCCCTTTGAATGGAGGCCAGATAGTACCATGATAGCTGTATCAACGGCAAATGGATACATCTTGTTTTTTCATATTACATCTACAAGAGGGGACAAGTACCTTTATGAACCAGTGTATCCCAAAGGAAGTCCACAAATGAAGGGGACACCCCATTTTAAGGAAGAACAGTGTGCTCCAGCATTAAATTTGGAGATGAGGAAAATACTGGATTTACAAGCACCCATCATGAGTTTGCAGTCTGTGTTGGAAGATCTCCTGGTTGCTACTTCTGATGGACTTCTTCATCTTATTCACTGGGAAGGAATGACAAATGGAAGGAAAGCCATTAATCTTTGCACAGTACCCTTTTCAGTAGACCTGCAGTCATCTAGAGTAGGTTCATTCCTGGGCTTCACAGACGTACACATCAGAGACATGGAATACTGTGCCACACTTGATGGGTTTGCTGTTGTATTTAATGATGGTAAAGTTGGATTTATTACACCAGTGTCAAGTAGATTTACTGCAGAGCAGCTTCATGGAGTTTGGCCACAAGATGTTGTTGACGGAACGTGTGTAGCAGTAAATAACAAGTATCGACTAATGGCATTTGGCTGTGTGAGTGGTTCTGTGCAGGTCTATACAATAGATAACAGCACTGGAGCCATGCTGCTATCTCATAAATTAGAGCTAACAGCAAAACAGTATCCTGACATTTGGAATAAAACAGGAGCTGTTAAATTGATGAGATGGTCTCCTGACAATAGTGTTGTAATAGTGACCTGGGAATACGGAGGCCTTTCTTTATGGAGTGTTTTTGGAGCACAGCTGATTTGTACACTTGGAGGAGATTTTGCTTATAGGTCTGATGGCACCAAAAAAGATCCCCTTAAGATCAACTCTATGAGCTGGGGTGCAGAAGGCTATCACCTATGGGTAATCAGCGGATTTGGTTCTCAAAACACTGAAATTGAGTCTGACCTCAGGAGTGTAGTTAAACAGCCCAGCATCCTGTTATTTCAGTTTATTAAGAGTGTACTCACTGTAAACCCTTGTATGAGTAACCAAGAGCAGGTGTTGCTTCAGGGTGAGGATCGCTTGTACTTGAACTGTGGAGAGGCTTCACAAACCCAGAATCCCAGGAGTTCTTCAACACACTCTGAGCATAAGCCCAGTCGAGAAAAGAGCCCATTTGCAGATGGAGGTTTAGAGTCTCAGGGATTAAGCACTTTACTTGGACATCGGCATTGGCATGTTGTACAGATTTCCAGCACCTATCTAGAGAGCAATTGGCCTATACGGTTTTCAGCTATTGATAAGCTTGGACAGAATATTGCTGTGGTTGGCAAGTTTGGTTTTGCACATTACTCTTTACTCACCAAAAAATGGAAACTTTTTGGAAACATTACCCAGGAGCAAAATATGATCGTGACAGGTGGCTTAGCCTGGTGGAATGATTTTATGGTCCTTGCGTGTTATAACATAAATGACCGTCAAGAAGAGCTTAGAGTATACTTGCGAACATCAAATCTGGACAATGCCTTTGCTCATGTCACCAAAGCACAAGCAGAAACATTACTGCTTAGTGTCTTCCAGGACATGGTAATAGTATTTAGAGCAGACTGTTCAATATGCCTTTACAGTATTGAAAGAAAATCTGATGGTCCAAATACTACTGCTGGTATTCAAGTTCTTCAGGAGGTTTCCATGTCACGCTACATTCCTCACCCTTTCCTGGTGGTATCTGTCACTCTGACATCAGTGAGTACAGAGAATGGAATCACCTTGAAAATGCCACAGCAGGCTCGTGGTGCAGAGAGCATTATGTTAAACCTGGCAGGACAGCTCATCATGATGCAGAGGGACAGGTCAGGCCCACAGATCCGGGAGAAGGACAGTAACCCTAATAACCAAAGGAAACTTCTGCCATTCTGTCCTCCTGTTGTACTAGCCCAGTCTGTTGAAAATGTCTGGACAACGTGTCGAGCAAATAAACAGAAACGTCACCTTCTGGAGGCCCTCTGGCTGAGCTGTGGTGGTGCAGGGATGAAAGTTTGGCTCCCTCTCTTCCCTAGGGATCACCGCAAGCCCCATTCCTTCTTGTCCCAGCGGATCATGCTGCCTTTCCACATCAACATTTACCCGCTAGCTGTTCTGTTTGAAGATGCTTTAGTCCTTGGTGCTGTCAATGACACTTTGCTCTATGATTCTTTATATACTCGGAACAATGCTAGAGAACAGCTGGAGGTGCTCTTCCCTTTCTGTGTTGTGGAGAGAACCTCTCAGATCTACCTCCACCACATTCTACGTCAACTTCTGGTCAGAAACCTTGGGGAGCAAGCCTTGCTCTTGGCCCAGTCCTGTGCCACATTACCTTACTTCCCTCATGTGCTGGAGCTCATGCTCCATGAAGTACTGGAAGAAGAAGCTACCTCACGGGAGCCCATTCCCGACCCTCTGCTTCCCACTGTGGCAAAATTTATCACTGAGTTCCCCCTCTTCCTGCAGACAGTTGTCCATTGTGCCAGGAAGACCGAATATGCCCTGTGGAATTACCTTTTTGCAGCTGTTGGAAACCCTAAGGACTTGTTTGAGGAGTGTTTGATGGCTCAGGATTTGGACACAGCTGCCTCTTACCTTATTATCTTACAGAATATGGAAGTCCCTGCAGTAAGTAGGCAACATGCTACCCTTCTATTCAACACAGCACTAGAACAAGGCAAGTGGGACCTTTGTCGACACATGATTCGATTTCTTAAAGCCATTGGCTCTGGAGAATCTGAGACACCTCCATCCACACCCACAGCTCAGGAACCCAGTTCAAGTGGTGGATTTGAGTTCTTCAGGAATCGAAGCATCAGTTTATCCCAGTCAGCTGAAAATGTTCCTGCCAGTAAATTCAGTTTACAGAAAACACTAAGTATGCCATCTGGTCCCTCTGGAAAAAGATGGAGCAAAGACAGTGACTGTGCTGAGAACATGTATATTGACATGATGCTCTGGAGACATGCTCGGCGCCTCTTAGAAGATGTGAGGTTAAAGGACCTTGGCTGCTTTGCAGCCCAGCTGGGCTTTGAACTAATTAGTTGGCTATGCAAGGAACGTACCCGAGCCGCCCGGGTAGACAACTTTGTAATAGCCCTGAAGAGACTCCACAAAGATTTCCTGTGGCCACTTCCAATCATCCCAGCCTCTTCTATCAGTTCTCCTTTCAAAAATGGAAAATACCGAACTGTGGGAGAGCAGCTGTTAAAGTCTCAATCAGCTGACCCATTTTTGAACCTTGAGATGGATGCTGGCATCTCCAACATCCAGCGAAGTCAGAGCTGGCTCAGCAACATTGGCCCCACCCATCATGAGATAGACACAGCTTCATCCCATGGACCACAAATGCAAGATGCCTTCTTGTCACCTTTATCTAATAAAGGTGATGAATGCAGTATTGGTTCAGCCACAGACTTGACTGAAAGTAGCTCCATGGTGGATGGCGACTGGACAATGGTGGATGAAAATTTCTCTACACTCAGTTTAACTCAGTCAGAGCTGGAGCACATTTCCATGGAGTTGGCCAGTAAAGGGCCTCATAAATCCCAGGTCCAGCTTCGGTATTTGCTACACATTTTCATGGAGGCAGGGTGCCTAGACTGGTGCATCGTTATAGGCCTGATTCTTAGAGAATCCTCAATAATCAATCAGATTTTGGTTATTACACAGTCTTCAGAGGTAGATGGAGAGATGTTACAGAACATAAAGACAGGGCTCCATGCAGTGGACCGATGGGCCTCTACAGACTGTCCTGGATATAAGCCATTTTTAAACATCATTAAGCCACAACTGCAGAAGCTCAGTGAGATAACAGAAGAGCAGGTCCAGCCAGATGCCTTCCAACCAATAACTATGGGTAAGACTCCAGAACAGACTAGCCCCCGGGCAGAGGAGAGCAGGGGCTCCTCCAGCCATGGAAGCATCCCCCAGGGTGAAGTTGGAAGCAGCAATATGGTCAGCCGGAAAGAGGAGGACACAGCC CAAGCAGAGGAGGAAGAACCTTTTCAGGATGGGACTTACGACTGTTCTGTGTCCTAACAGTGAGGTTCCATCACAAAGGGGCAGTATTAATTAGCAGCAGCGTGCAGCTAAGGGCGAATTCCAGCACACTGGCGGCCGTTACTAGTGGATCCGAGCTCGGTACCAAGCTTGATGCATAGCTTGAGTATTCTAACGCGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGCCCAGGAACCGTAAAAAGGC

Sequencing Information:

Phred Score: 824
Date: 2014-04-21

Last Passing Sequencing Read:

NNAAACGCTCTATAGGGATTGGGCCGCGAGATGCATGCTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCGCCCTTTGAATGGAGGCCAGATAGTACCATGATAGCTGTATCAACGGCAAATGGATACATCTATGTTTTTTCATATTACATCTACAAGAGGGGACAAGTACCTTTATGAACCAGTGTATCCCAAAGGAAGTCCACAAATGAAGGGGACACCCCATTTTAAGGAAGAACAGTGTGCTCCAGCATTAAATTTGGAGATGAGGAAAATACTGGATTTACAAGCACCCATCATGAGTTTGCAGTCTGTGTTGGAAGATCTCCTGGTTGCTACTTCTGATGGACTTCTTCATCTTATTCACTGGGAAGGAATGACAAATGGAAGGAAAGCCATTAATCTTTGCACAGTACCCTTTTCAGTAGACCTGCAGTCATCTAGAGTAGGTTCATTCCTGGGCTTCACAGACGTACACATCAGAGACATGGAATACTGTGCCACACTTGATGGGTTTGCTGTTGTATTTAATGATGGTAAAGTTGGATTTATTACACCAGTGTCAAGTAGATTTACTGCACAGCAGCTTCATGGAGTTTGGCCACAAGATGTTGTTGACGGAACGTGTGTAGCAGTAAATAACAAGTATCGACTAATGGCATTTGGCTGTGTGAGTGGTTCTGTGCAGGTCTATACAATAGATAACAGCACTGGAGCCATGCTGCTATCTCATAAATTAGAGCTAACAGCAAAACAGTATCCTGACATTTGGAATAAAACAGGAGCTGTTAAATTGATGAGATGGTCTCCTGACAATAGTGTTGTAATAGTGACCTGNGCATACGGAGGCCTTTCTTTATGGAGTGTCTTTGGAGCACAGCTGATTTGTACACTTGGAGGAGATTTTGCTTATAGGTCTGATGGCACAAAAAAGATCCCCTTAAGATCACTCTATGAGCTGGGGTGCAGAGGCTATCACCTATGGTTATCAGCGGATTTGGTCTCAAACACTGAAATTGAGTCTGACCTCGGAATTGTATTAACAGCCCAACATCCGTTTATTTCATTTATTAGAGTGTACTCACTGAAACCCTGTATTGATACCAGACCAGTGTTGCTTCAGGGGAGGAATCTTGACTTAACTGGGAAAGCTTCCAACCCAGATCCCGGATCTTCAACACCTTGATCTAACCGCTCAAACAACCACTTCCATGAGATTAGAACTCGGTAATCCNCTTTGGAATGGNTTGTGGTTTAAAATTCCCCCTTTGAGAATTGCCTACGGTTCCCTTGAAATGAAAAATATGGGTTGAATTGTTTTCCTCCTTTCTCCAAGGATTTTAAACTCCCAAAAATCCAGGGCTCCGGGAATATTCTGTTTAAAACCAAGTAATTTGATATTGATGTTCTCAAACAAACTGTCCAAAATAAAAATTTAAAAAAACANNNNNNNNNCCTCTCTTTTAAAACCGTTTTTCGCCACCTCACTAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Vector Information:

Vector Name:pCR-XL-TOPO
Type:bacterial plasmid
Description:TOPO Cloning vector for bacterial expression; kanamycin resistance in bacteria
Properties:bacterial expression
Comments:This vector has both kanamycin and zeocin resistance
Map:xltopo.bmp
Sequence:pCR_XL_TOPO.txt
Size (bp):3500
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha N

Antibiotic Selections:

Host Type Marker
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 50ug/mL kanamycin Growth with the single antibiotic in LB at 37 degrees is recommended. Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.

Authors:

Author Name Author Type
MGC Consortium