Clone: HsCD00342172

Clone ID:HsCD00342172
Is Verified:Y
Status:AVAILABLE
Source:MGC
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

Original Clone ID MGC:168140
IMAGE ID 9020517
GI 187953260
GenBank Accession BC136527

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 4054 Homo sapiens CLOSED 23368 PPP1R13B protein phosphatase 1, regulatory (inhibitor) subunit 13B
Insert1
Size (bp)4054
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 23368
Gene SymbolPPP1R13B
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 13B
Keyword

Insert Sequence:

CTTAGGAGGCGGCCGGAGCGGTGGGCACAGCTCGGCGCGGAGCGTCCTGTCAGGCGGCGGCCGAGGGCGTCGCGGACTCTCCCCGCGATGATGCCGATGATATTAACTGTTTTCTTGAGCAACAATGAACAGATTTTAACAGAAGTTCCTATAACACCGGAAACAACCTGTCGAGATGTTGTAGAATTTTGCAAGGAACCTGGAGAAGGCAGCTGCCATTTAGCTGAAGTGTGGAGGGGAAATGAACGTCCCATACCCTTTGATCATATGATGTACGAACATCTTCAGAAATGGGGTCCACGGAGGGAAGAAGTGAAATTTTTCCTTCGACACGAGGACTCCCCAACTGAGAACAGTGAACAAGGTGGCCGTCAGACCCAAGAGCAACGAACTCAGAGAAATGTAATAAATGTACCTGGAGAAAAACGTACTGAAAATGGGGTTGGGAATCCACGTGTTGAACTTACCCTCTCAGAGCTCCAAGATATGGCAGCTAGGCAACAGCAGCAGATTGAAAATCAGCAGCAGATGTTGGTTGCCAAGGAACAGCGTTTACATTTTCTAAAGCAACAGGAGCGCCGTCAGCAGCAGTCTATTTCTGAAAATGAAAAGCTTCAGAAATTGAAAGAACGAGTTGAAGCCCAGGAGAACAAGCTGAAGAAAATTCGTGCAATGAGAGGACAAGTCGACTACAGCAAAATCATGAACGGCAATCTGTCTGCTGAAATAGAAAGGTTCAGTGCCATGTTCCAGGAAAAGAAGCAGGAAGTACAGACTGCAATTTTAAGGGTTGATCAGCTTAGTCAGCAATTGGAAGATTTAAAGAAAGGAAAACTGAATGGGTTCCAGTCTTACAATGGCAAATTGACGGGACCAGCGGCGGTGGAGTTAAAAAGACTGTACCAAGAACTACAGATTCGTAACCAACTTAACCAGGAACAAAATTCAAAACTTCAGCAGCAGAAGGAACTCTTAAATAAGCGCAACATGGAGGTGGCCATGATGGACAAGCGAATCAGTGAACTGCGTGAACGTCTCTATGGGAAAAAAATTCAGCTGAACCGTGTGAATGGCACGTCATCACCACAGTCCCCTCTGAGCACATCGGGCAGGGTCGCTGCTGTGGGGCCTTATATCCAGGTTCCCAGTGCCGGAAGCTTTCCTGTGCTGGGGGACCCTATAAAGCCCCAGTCTCTCAGTATTGCCTCAAATGCTGCTCATGGAAGATCCAAATCCGCTAATGATGGAAACTGGCCAACATTAAAACAGAATTCTAGCTCTTCCGTGAAACCAGTGCAGGTGGCCGGTGCAGACTGGAAGGATCCGAGCGTGGAGGGGTCTGTCAAGCAGGGCACTGTCTCCAGCCAGCCTGTGCCCTTCTCAGCACTGGGACCCACGGAGAAGCCGGGCATCGAGATTGGTAAAGTGCCACCTCCCATCCCGGGTGTAGGCAAGCAGCTGCCTCCAAGCTATGGGACATACCCAAGTCCTACACCTCTGGGTCCTGGGTCGACAAGCTCCCTGGAAAGGAGGAAGGAAGGCAGCTTGCCCAGGCCCAGTGCAGGCCTGCCAAGTCGACAGAGGCCCACCCTGCTGCCCGCCACAGGCAGCACCCCCCAGCCAGGCTCCTCACAACAGATTCAGCAGAGGATTTCCGTACCGCCAAGTCCCACGTACCCGCCAGCGGGACCACCTGCATTTCCAGCTGGGGACAGCAAGCCTGAACTCCCACTGACAGTGGCCATTAGGCCTTTCCTGGCTGATAAAGGGTCAAGGCCACAGTCTCCCAGGAAAGGACCCCAGACAGTGAATTCAAGTTCCATATACTCCATGTACCTCCAGCAAGCCACACCACCTAAGAATTACCAGCCGGCAGCACACAGCGCCTTAAATAAGTCAGTTAAAGCAGTGTATGGTAAGCCCGTTTTACCTTCGGGTTCAACCTCTCCATCGCCGCTGCCGTTTCTTCACGGGTCACTGTCCACGGGCACACCACAGCCTCAGCCACCTTCAGAAAGTACTGAGAAAGAGCCTGAGCAGGATGGCCCCGCCGCCCCCGCAGATGGCAGCACCGTGGAGAGCCTGCCACGGCCACTCAGCCCCACCAAGCTCACGCCCATCGTGCATTCGCCACTGCGCTACCAGAGTGATGCAGACCTGGAGGCCCTCCGCAGGAAGCTGGCCAACGCGCCCCGGCCCCTGAAAAAGCGCAGCTCCATCACAGAGCCCGAGGGCCCCGGCGGGCCCAACATCCAGAAGCTGCTGTACCAGCGCTTCAACACCCTGGCCGGTGGCATGGAGGGCACCCCTTTCTACCAGCCCAGCCCCTCCCAGGACTTCATGGGCACCTTGGCCGATGTGGACAATGGAAACACCAATGCCAATGGAAACCTGGAAGAGCTCCCCCCTGCCCAGCCCACAGCCCCACTCCCCGCTGAGCCTGCCCCGTCATCAGATGCCAATGATAATGAGTTACCTTCCCCCGAACCAGAGGAGCTCATCTGTCCCCAAACCACCCACCAAACTGCCGAGCCGGCAGAGGACAATAACAACAACGTGGCCACGGTCCCCACCACGGAGCAGATCCCGAGTCCTGTGGCTGAGGCCCCATCTCCAGGGGAAGAGCAGGTCCCTCCAGCACCTCTTCCCCCTGCCAGCCACCCTCCTGCCACCTCCACGAACAAGCGGACCAACTTGAAGAAGCCCAACTCGGAGCGGACGGGGCACGGGCTGAGAGTCCGGTTTAACCCCCTGGCACTGCTCCTAGACGCGTCTCTGGAAGGAGAGTTCGATCTGGTGCAGAGGATCATCTATGAGGTGGAAGATCCCAGCAAGCCCAACGACGAAGGGATCACCCCACTGCACAACGCCGTCTGCGCCGGCCACCATCACATCGTGAAGTTCCTGCTGGATTTTGGTGTCAACGTGAATGCTGCTGATAGTGATGGATGGACGCCGCTGCACTGCGCTGCCTCTTGTAACAGCGTTCACCTCTGCAAACAGCTGGTGGAGAGTGGTGCCGCCATTTTTGCCTCAACCATAAGCGACATTGAAACTGCTGCAGACAAGTGTGAGGAGATGGAGGAAGGCTACATCCAGTGCTCCCAGTTTCTATATGGGGTGCAGGAAAAGCTGGGTGTGATGAACAAAGGTGTGGCGTATGCTCTGTGGGACTACGAGGCCCAGAACAGTGACGAGCTGTCCTTCCACGAAGGGGACGCCCTCACCATCCTGAGGCGCAAGGACGAAAGCGAGACTGAGTGGTGGTGGGCTCGCCTTGGAGACCGGGAGGGCTATGTGCCCAAAAACCTGCTGGGGCTGTATCCACGGATCAAACCCCGACAGCGAACACTCGCCTGAACTTCCTTTTGGAGCACCGCATGGTCTTGCCAGCTACCAGGAGCCACTTAAGAGATTATTGTGCTGTTTTCCAGGAAAGCTGCAGCTAGAAAATGGTCTTAATGGTGCTCACTTTAGCAGACAGCGTCCACAATGTGAATCCTACAGTTTCCAGGTGAGGCCCTTTCTCCAGTTTGCCCATTAACTGGGAGAGGTACTTTCGCCTCCAAGGACTGAATTTTGCCAATTACTATAAATCCAAATAAATACCCACTTTCAAAACACCCACCCCTCTTGCCATTAAGAAGTCCCATAACCCCCGGTTGGTTGCCAGTGAAGACAGAAGCTCTTACTGACTTGGCCCCGAGGCCATCACCCCCTCCAGCAGTGAACACTGTCCGCCGCTGTGAGGCCTGCTCCCCTGCGACCGCCCTGCCCCCCGTCACCGAATCGGACACTCATCCTTTCTCACACTTCCCACACATGATCCTTCTTCCCTTCATCACCAAAGGAGCCTCTGTATGGAAACATGTCCAGTGTTGCTGCCCAGTGTGTATGCCTCCCAGTACCCACTCTGCTCGGCCGCCTTGGGGGTTCCGCTTCCTGTTCCAGTTCACCTAAAGGCTGATTGTGCAGGCCCAGCACTGTGGCTGGACTGCCG CGCCACGGGCACCAGGACCCCTAAGACCAAGTGACAACTGGGAGAGCCTCAGCA

Insert Property: Insert 1

Type Value Extra Information
CDS Start 88
CDS Stop 3360

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAGCACGTGTCAGTCCTGCTCCTCGGCCACGAAGTGCACGCAGTTGCCGGCCGGGTCGCGCAGGGCGAACTCCCGCCCCCACGGCTGCTCGCCGATCTCGGTCATGGCCGGCCCGGAGGCGTCCCGGAAGTTCGTGGACACGACCTCCGACCACTCGGCGTACAGCTCGTCCAGGCCGCGCACCCACACCCAGGCCAGGGTGTTGTCCGGCACCACCTGGTCCTGGACCGCGCTGATGAACAGGGTCACGTCGTCCCGGACCACACCGGCGAAGTCGTCCTCCACGAAGTCCCGGGAGAACCCGAGCCGGTCGGTCCAGAACTCGACCGCTCCGGCGACGTCGCGCGCGGTGAGCACCGGAACGGCACTGGTCAACTTGGCCATGGTGGCCCTCCTCACGTGCTATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGTATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGAAATTGTAAGCGTTAATAATTCAGAAGAACTCGTCAAGAAGGCGATAGAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGTCAGCCCATTCGCCGCCAAGCTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCTGATAGCGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTTCCACCATGATATTCGGCAAGCAGGCATCGCCATGGGTCACGACGAGATCCTCGCCGTCGGGCATGCTCGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATGCTCTTCGTCCAGATCATCCTGATCGACAAGACCGGCTTCCATCCGAGTACGTGCTCGCTCGATGCGATGTTTCGCTTGGTGGTCGAATGGGCAGGTAGCCGGATCAAGCGTATGCAGCCGCCGCATTGCATCAGCCATGATGGATACTTTCTCGGCAGGAGCAAGGTGAGATGACAGGAGATCCTGCCCCGGCACTTCGCCCAATAGCAGCCAGTCCCTTCCCGCTTCAGTGACAACGTCGAGCACAGCTGCGCAAGGAACGCCCGTCGTGGCCAGCCACGATAGCCGCGCTGCCTCGTCTTGCAGTTCATTCAGGGCACCGGACAGGTCGGTCTTGACAAAAAGAACCGGGCGCCCCTGCGCTGACAGCCGGAACACGGCGGCATCAGAGCAGCCGATTGTCTGTTGTGCCCAGTCATAGCCGAATAGCCTCTCCACCCAAGCGGCCGGAGAACCTGCGTGCAATCCATCTTGTTCAATCATGCGAAACGATCCTCATCCTGTCTCTTGATCAGAGCTTGATCCCCTGCGCCATCAGATCCTTGGCGGCGAGAAAGCCATCCAGTTTACTTTGCAGGGCTTCCCAACCTTACCAGAGGGCGCCCCAGCTGGCAATTCCGGTTCGCTTGCTGTCCATAAAACCGCCCAGTCTAGCTATCGCCATGTAAGCCCACTGCAAGCTACCTGCTTTCTCTTTGCGCTTGCGTTTTCCCTTGTCCAGATAGCCCAGTAGCTGACATTCATCCGGGGTCAGCACCGTTTCTGCGGACTGGCTTTCTACGTGAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGCCTGACATTTATATTCCCCAGAACATCAGGTTAATGGCGTTTTTGATGTCATTTTCGCGGTGGCTGAGATCAGCCACTTCTTCCCCGATAACGGAGACCGGCACACTGGCCATATCGGTGGTCATCATGCGCCAGCTTTCATCCCCGATATGCACCACCGGGTAAAGTTCACGGGAGACTTTATCTGACAGCAGACGTGCACTGGCCAGGGGGATCACCATCCGTCGCCCCGGCGTGTCAATAATATCACTCTGTACATCCACAAACAGACGATAACGGCTCTCTCTTTTATAGGTGTAAACCTTAAACTGCCGTACGTATAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGGCCCTCTAGATGCATGCTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCGCCCTTCTTAGGAGGCGGCCGGAGCGGTGGGCACAGCTCGGCGCGGAGCGTCCTGTCAGGCGGCGGCCGAGGGCGTCGCGGACTCTCCCCGCGATGATGCCGATGATATTAACTGTTTTCTTGAGCAACAATGAACAGATTTTAACAGAAGTTCCTATAACACCGGAAACAACCTGTCGAGATGTTGTAGAATTTTGCAAGGAACCTGGAGAAGGCAGCTGCCATTTAGCTGAAGTGTGGAGGGGAAATGAACGTCCCATACCCTTTGATCATATGATGTACGAACATCTTCAGAAATGGGGTCCACGGAGGGAAGAAGTGAAATTTTTCCTTCGACACGAGGACTCCCCAACTGAGAACAGTGAACAAGGTGGCCGTCAGACCCAAGAGCAACGAACTCAGAGAAATGTAATAAATGTACCTGGAGAAAAACGTACTGAAAATGGGGTTGGGAATCCACGTGTTGAACTTACCCTCTCAGAGCTCCAAGATATGGCAGCTAGGCAACAGCAGCAGATTGAAAATCAGCAGCAGATGTTGGTTGCCAAGGAACAGCGTTTACATTTTCTAAAGCAACAGGAGCGCCGTCAGCAGCAGTCTATTTCTGAAAATGAAAAGCTTCAGAAATTGAAAGAACGAGTTGAAGCCCAGGAGAACAAGCTGAAGAAAATTCGTGCAATGAGAGGACAAGTCGACTACAGCAAAATCATGAACGGCAATCTGTCTGCTGAAATAGAAAGGTTCAGTGCCATGTTCCAGGAAAAGAAGCAGGAAGTACAGACTGCAATTTTAAGGGTTGATCAGCTTAGTCAGCAATTGGAAGATTTAAAGAAAGGAAAACTGAATGGGTTCCAGTCTTACAATGGCAAATTGACGGGACCAGCGGCGGTGGAGTTAAAAAGACTGTACCAAGAACTACAGATTCGTAACCAACTTAACCAGGAACAAAATTCAAAACTTCAGCAGCAGAAGGAACTCTTAAATAAGCGCAACATGGAGGTGGCCATGATGGACAAGCGAATCAGTGAACTGCGTGAACGTCTCTATGGGAAAAAAATTCAGCTGAACCGTGTGAATGGCACGTCATCACCACAGTCCCCTCTGAGCACATCGGGCAGGGTCGCTGCTGTGGGGCCTTATATCCAGGTTCCCAGTGCCGGAAGCTTTCCTGTGCTGGGGGACCCTATAAAGCCCCAGTCTCTCAGTATTGCCTCAAATGCTGCTCATGGAAGATCCAAATCCGCTAATGATGGAAACTGGCCAACATTAAAACAGAATTCTAGCTCTTCCGTGAAACCAGTGCAGGTGGCCGGTGCAGACTGGAAGGATCCGAGCGTGGAGGGGTCTGTCAAGCAGGGCACTGTCTCCAGCCAGCCTGTGCCCTTCTCAGCACTGGGACCCACGGAGAAGCCGGGCATCGAGATTGGTAAAGTGCCACCTCCCATCCCGGGTGTAGGCAAGCAGCTGCCTCCAAGCTATGGGACATACCCAAGTCCTACACCTCTGGGTCCTGGGTCGACAAGCTCCCTGGAAAGGAGGAAGGAAGGCAGCTTGCCCAGGCCCAGTGCAGGCCTGCCAAGTCGACAGAGGCCCACCCTGCTGCCCGCCACAGGCAGCACCCCCCAGCCAGGCTCCTCACAACAGATTCAGCAGAGGATTTCCGTACCGCCAAGTCCCACGTACCCGCCAGCGGGACCACCTGCATTTCCAGCTGGGGACAGCAAGCCTGAACTCCCACTGACAGTGGCCATTAGGCCTTTCCTGGCTGATAAAGGGTCAAGGCCACAGTCTCCCAGGAAAGGACCCCAGACAGTGAATTCAAGTTCCATATACTCCATGTACCTCCAGCAAGCCACACCACCTAAGAATTACCAGCCGGCAGCACACAGCGCCTTAAATAAGTCAGTTAAAGCAGTGTATGGTAAGCCCGTTTTACCTTCGGGTTCAACCTCTCCATCGCCGCTGCCGTTTCTTCACGGGTCACTGTCCACGGGCACACCACAGCCTCAGCCACCTTCAGAAAGTACTGAGAAAGAGCCTGAGCAGGATGGCCCCGCCGCCCCCGCAGATGGCAGCACCGTGGAGAGCCTGCCACGGCCACTCAGCCCCACCAAGCTCACGCCCATCGTGCATTCGCCACTGCGCTACCAGAGTGATGCAGACCTGGAGGCCCTCCGCAGGAAGCTGGCCAACGCGCCCCGGCCCCTGAAAAAGCGCAGCTCCATCACAGAGCCCGAGGGCCCCGGCGGGCCCAACATCCAGAAGCTGCTGTACCAGCGCTTCAACACCCTGGCCGGTGGCATGGAGGGCACCCCTTTCTACCAGCCCAGCCCCTCCCAGGACTTCATGGGCACCTTGGCCGATGTGGACAATGGAAACACCAATGCCAATGGAAACCTGGAAGAGCTCCCCCCTGCCCAGCCCACAGCCCCACTCCCCGCTGAGCCTGCCCCGTCATCAGATGCCAATGATAATGAGTTACCTTCCCCCGAACCAGAGGAGCTCATCTGTCCCCAAACCACCCACCAAACTGCCGAGCCGGCAGAGGACAATAACAACAACGTGGCCACGGTCCCCACCACGGAGCAGATCCCGAGTCCTGTGGCTGAGGCCCCATCTCCAGGGGAAGAGCAGGTCCCTCCAGCACCTCTTCCCCCTGCCAGCCACCCTCCTGCCACCTCCACGAACAAGCGGACCAACTTGAAGAAGCCCAACTCGGAGCGGACGGGGCACGGGCTGAGAGTCCGGTTTAACCCCCTGGCACTGCTCCTAGACGCGTCTCTGGAAGGAGAGTTCGATCTGGTGCAGAGGATCATCTATGAGGTGGAAGATCCCAGCAAGCCCAACGACGAAGGGATCACCCCACTGCACAACGCCGTCTGCGCCGGCCACCATCACATCGTGAAGTTCCTGCTGGATTTTGGTGTCAACGTGAATGCTGCTGATAGTGATGGATGGACGCCGCTGCACTGCGCTGCCTCTTGTAACAGCGTTCACCTCTGCAAACAGCTGGTGGAGAGTGGTGCCGCCATTTTTGCCTCAACCATAAGCGACATTGAAACTGCTGCAGACAAGTGTGAGGAGATGGAGGAAGGCTACATCCAGTGCTCCCAGTTTCTATATGGGGTGCAGGAAAAGCTGGGTGTGATGAACAAAGGTGTGGCGTATGCTCTGTGGGACTACGAGGCCCAGAACAGTGACGAGCTGTCCTTCCACGAAGGGGACGCCCTCACCATCCTGAGGCGCAAGGACGAAAGCGAGACTGAGTGGTGGTGGGCTCGCCTTGGAGACCGGGAGGGCTATGTGCCCAAAAACCTGCTGGGGCTGTATCCACGGATCAAACCCCGACAGCGAACACTCGCCTGAACTTCCTTTTGGAGCACCGCATGGTCTTGCCAGCTACCAGGAGCCACTTAAGAGATTATTGTGCTGTTTTCCAGGAAAGCTGCAGCTAGAAAATGGTCTTAATGGTGCTCACTTTAGCAGACAGCGTCCACAATGTGAATCCTACAGTTTCCAGGTGAGGCCCTTTCTCCAGTTTGCCCATTAACTGGGAGAGGTACTTTCGCCTCCAAGGACTGAATTTTGCCAATTACTATAAATCCAAATAAATACCCACTTTCAAAACACCCACCCCTCTTGCCATTAAGAAGTCCCATAACCCCCGGTTGGTTGCCAGTGAAGACAGAAGCTCTTACTGACTTGGCCCCGAGGCCATCACCCCCTCCAGCAGTGAACACTGTCCGCCGCTGTGAGGCCTGCTCCCCTGCGACCGCCCTGCCCCCCGTCACCGAATCGGACACTCATCCTTTCTCACACTTCCCACACATGATCCTTCTTCCCTTCATCACCAAAGGAGCCTCTGTATGGAAACATGTCCAGTGTTGCTGCCCAGTGTGTATGCCTCCCAGTACCCACTCTGCTCGGCCGCCTTGGGGGTTCCGCTTCCTGTTCCAGTTCACCTAAAGGCTGATTGTGCAGGCCCAGCACTGTGGCTGGACTGCCG CGCCACGGGCACCAGGACCCCTAAGACCAAGTGACAACTGGGAGAGCCTCAGCAAAGGGCGAATTCCAGCACACTGGCGGCCGTTACTAGTGGATCCGAGCTCGGTACCAAGCTTGATGCATAGCTTGAGTATTCTAACGCGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGCCCAGGAACCGTAAAAAGGC

Vector Information:

Vector Name:pCR-XL-TOPO
Type:bacterial plasmid
Description:TOPO Cloning vector for bacterial expression; kanamycin resistance in bacteria
Properties:bacterial expression
Comments:This vector has both kanamycin and zeocin resistance
Map:xltopo.bmp
Sequence:pCR_XL_TOPO.txt
Size (bp):3500
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha N

Antibiotic Selections:

Host Type Marker
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 50ug/mL kanamycin Growth with the single antibiotic in LB at 37 degrees is recommended. Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.

Authors:

Author Name Author Type
MGC Consortium