Clone: HsCD00341254

Clone ID:HsCD00341254
Is Verified:Y
Status:AVAILABLE
Source:MGC
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

Original Clone ID MGC:126642
IMAGE ID 8069099
GI 75516610
GenBank Accession BC101593

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 792 Homo sapiens CLOSED 3024 HIST1H1A histone cluster 1, H1a
Insert1
Size (bp)792
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 3024
Gene SymbolHIST1H1A
Gene Namehistone cluster 1, H1a
Keyword

Insert Sequence:

GCTGCGTTGGGGCCTTTTTTTTTCGCATCCTGCTTCGTCAGGTTTATACCACTTTATTTGGTGTGCTGTGTTAGTCACCATGTCTGAAACAGTGCCTCCCGCCCCCGCCGCTTCTGCTGCTCCTGAGAAACCTTTAGCTGGCAAGAAGGCAAAGAAACCTGCTAAGGCTGCAGCAGCCTCCAAGAAAAAACCCGCTGGCCCTTCCGTGTCAGAGCTGATCGTGCAGGCTGCTTCCTCCTCTAAGGAGCGTGGTGGTGTGTCGTTGGCAGCTCTTAAAAAGGCGCTGGCGGCCGCAGGCTACGACGTGGAGAAGAACAACAGCCGCATTAAGCTGGGCATTAAGAGCCTGGTAAGCAAGGGAACGTTGGTGCAGACAAAGGGTACCGGAGCCTCGGGTTCCTTCAAGCTCAACAAGAAGGCGTCCTCCGTGGAAACCAAGCCCGGCGCCTCAAAGGTGGCTACAAAAACTAAGGCAACGGGTGCATCTAAAAAGCTCAAAAAGGCCACGGGGGCTAGCAAAAAGAGCGTCAAGACTCCGAAAAAGGCTAAAAAGCCTGCGGCAACAAGGAAATCCTCCAAGAATCCAAAAAAACCCAAAACTGTAAAGCCCAAGAAAGTAGCTAAAAGCCCTGCTAAAGCTAAGGCTGTAAAACCCAAGGCGGCCAAGGCTAGGGTGACGAAGCCAAAGACTGCCAAACCCAAGAAAGCGGCACCCAAGAAAAAGTAAATTCAGTTAGAAGTTTCTTCTAGTAACCCAACGGCTCTTTTAAGAGCCACCTACGCATTTCAGGA

Insert Property: Insert 1

Type Value Extra Information
CDS Start 80
CDS Stop 727

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

AGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTCAGAATTAACCCTCACTAAAGGGACTAGTCCTGCAGGTTTAAACGAATTCGCCCTTGCTGCGTTGGGGCCTTTTTTTTTCGCATCCTGCTTCGTCAGGTTTATACCACTTTATTTGGTGTGCTGTGTTAGTCACCATGTCTGAAACAGTGCCTCCCGCCCCCGCCGCTTCTGCTGCTCCTGAGAAACCTTTAGCTGGCAAGAAGGCAAAGAAACCTGCTAAGGCTGCAGCAGCCTCCAAGAAAAAACCCGCTGGCCCTTCCGTGTCAGAGCTGATCGTGCAGGCTGCTTCCTCCTCTAAGGAGCGTGGTGGTGTGTCGTTGGCAGCTCTTAAAAAGGCGCTGGCGGCCGCAGGCTACGACGTGGAGAAGAACAACAGCCGCATTAAGCTGGGCATTAAGAGCCTGGTAAGCAAGGGAACGTTGGTGCAGACAAAGGGTACCGGAGCCTCGGGTTCCTTCAAGCTCAACAAGAAGGCGTCCTCCGTGGAAACCAAGCCCGGCGCCTCAAAGGTGGCTACAAAAACTAAGGCAACGGGTGCATCTAAAAAGCTCAAAAAGGCCACGGGGGCTAGCAAAAAGAGCGTCAAGACTCCGAAAAAGGCTAAAAAGCCTGCGGCAACAAGGAAATCCTCCAAGAATCCAAAAAAACCCAAAACTGTAAAGCCCAAGAAAGTAGCTAAAAGCCCTGCTAAAGCTAAGGCTGTAAAACCCAAGGCGGCCAAGGCTAGGGTGACGAAGCCAAAGACTGCCAAACCCAAGAAAGCGGCACCCAAGAAAAAGTAAATTCAGTTAGAAGTTTCTTCTAGTAACCCAACGGCTCTTTTAAGAGCCACCTACGCATTTCAGGAAGTTCGAGAAGGGCGAATTCGCGGCCGCTAAATTCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTATACGTACGGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATGTACAGAGTGATATTATTGACACGCCGGGGCGACGGATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCTCCCGTGAACTTTACCCGGTGGTGCATATCGGGGATGAAAGCTGGCGCATGATGACCACCGATATGGCCAGTGTGCCGGTCTCCGTTATCGGGGAAGAAGTGGCTGATCTCAGCCACCGCGAAAATGACATCAAAAACGCCATTAACCTGATGTTCTGGGGAATATAAATGTCAGGCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTCACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGGATGAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGCAGGTAGCTTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGCTCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAAGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGAGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAATTATTAACGCTTACAATTTCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAA

Vector Information:

Vector Name:pCR4-TOPO
Type:bacterial plasmid
Description:TOPO Cloning vector with ampicillin resistance in bacteria.
Properties:TOPO Cloning
Comments:
Map:pCR4TopoTA.bmp
Sequence:CR4Topo.txt
Size (bp):3956
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
MGC Consortium