Clone: HsCD00340499

Clone ID:HsCD00340499
Is Verified:Y
Status:AVAILABLE
Source:MGC
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

IMAGE ID 7262187
GenBank Accession BC069492
Original Clone ID MGC:96978
GI 46854339

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 749 Homo sapiens CLOSED 3024 HIST1H1A histone cluster 1, H1a
Insert1
Size (bp)749
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 3024
Gene SymbolHIST1H1A
Gene Namehistone cluster 1, H1a
Keyword

Insert Sequence:

CCTGCTTCGTCAGGTTTATACCACTTTATTTGGTGTGCTGTGTTAGTCACCATGTCTGAAACAGTGCCTCCCGCCCCCGCCGCTTCTGCTGCTCCTGAGAAACCTTTAGCTGGCAAGAAGGCAAAGAAACCTGCTAAGGCTGCAGCAGCCTCCAAGAAAAAACCCGCTGGCCCTTCCGTGTCAGAGCTGATCGTGCAGGCTGCTTCCTCCTCTAAGGAGCGTGGTGGTGTGTCGTTGGCAGCTCTTAAAAAGGCGCTGGCGGCCGCAGGCTACGACGTGGAGAAGAACAACAGCCGCATTAAGCTGGGCATTAAGAGCCTGGTAAGCAAGGGAACGTTGGTGCAGACAAAGGGTACCGGAGCCTCGGGTTCCTTCAAGCTCAACAAGAAGGCGTCCTCCGTGGAAACCAAGCCCGGCGCCTCAAAGGTGGCTACAAAAACTAAGGCAACGGGTGCATCTAAAAAGCTCAAAAAGGCCACGGGGGCTAGCAAAAAGAGCGTCAAGACTCCGAAAAAGGCTAAAAAGCCTGCGGCAACAAGGAAATCCTCCAAGAATCCAAAAAAACCCAAAACTGTAAAGCCCAAGAAAGTAGCTAAAAGCCCTGCTAAAGCTAAGGCTGTAAAACCCAAGGCGGCCAAGGCTAGGGTGACGAAGCCAAAGACTGCCAAACCCAAGAAAGCGGCACCCAAGAAAAAGTAAATTCAGTTAGAAGTTTCTTCTAGTAACCCAACGGCTCTTTTAAGAGCCAC

Insert Property: Insert 1

Type Value Extra Information
CDS Start 52
CDS Stop 699

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGCGAATTGGGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGGATCCGCCCCCTGCTTCGTCAGGTTTATACCACTTTATTTGGTGTGCTGTGTTAGTCACCATGTCTGAAACAGTGCCTCCCGCCCCCGCCGCTTCTGCTGCTCCTGAGAAACCTTTAGCTGGCAAGAAGGCAAAGAAACCTGCTAAGGCTGCAGCAGCCTCCAAGAAAAAACCCGCTGGCCCTTCCGTGTCAGAGCTGATCGTGCAGGCTGCTTCCTCCTCTAAGGAGCGTGGTGGTGTGTCGTTGGCAGCTCTTAAAAAGGCGCTGGCGGCCGCAGGCTACGACGTGGAGAAGAACAACAGCCGCATTAAGCTGGGCATTAAGAGCCTGGTAAGCAAGGGAACGTTGGTGCAGACAAAGGGTACCGGAGCCTCGGGTTCCTTCAAGCTCAACAAGAAGGCGTCCTCCGTGGAAACCAAGCCCGGCGCCTCAAAGGTGGCTACAAAAACTAAGGCAACGGGTGCATCTAAAAAGCTCAAAAAGGCCACGGGGGCTAGCAAAAAGAGCGTCAAGACTCCGAAAAAGGCTAAAAAGCCTGCGGCAACAAGGAAATCCTCCAAGAATCCAAAAAAACCCAAAACTGTAAAGCCCAAGAAAGTAGCTAAAAGCCCTGCTAAAGCTAAGGCTGTAAAACCCAAGGCGGCCAAGGCTAGGGTGACGAAGCCAAAGACTGCCAAACCCAAGAAAGCGGCACCCAAGAAAAAGTAAATTCAGTTAGAAGTTTCTTCTAGTAACCCAACGGCTCTTTTAAGAGCCACGGGCTAGAGCGGCCGCCACCGCGGTGGAGCTCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCAC

Vector Information:

Vector Name:pPCR-Script Amp SK(+)
Type:bacterial plasmid
Description:Donor (entry) clone, inducible bacterial expression with lacZ' and lac promoter region. M13 forward, T7, T3 and M13 reverse primers. Ampicillin resistance in bacteria
Properties:inducible expression
Comments:
Map:pPCRScriptAmpSKPlus.bmp
Sequence:pPCR_Script_Amp_SK(+).txt
Size (bp):2961
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
MGC Consortium