Clone: HsCD00339613

Clone ID:HsCD00339613
Is Verified:Y
Status:AVAILABLE
Source:MGC
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

IMAGE ID 6171598
GI 41946877
GenBank Accession BC065927
Original Clone ID MGC:70843

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 3750 Homo sapiens CLOSED 57576 KIF17 kinesin family member 17
Insert1
Size (bp)3750
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 57576
Gene SymbolKIF17
Gene Namekinesin family member 17
Keyword

Insert Sequence:

CTTGGCCCGGGCTGCTGGGAGTCCCCGGCGGGGCGGGGGTCAGCTCTGGTCCCGGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTCCCATGAACCAGCGGGAGCGAGAGCTGCGCTGCCAGCCCGTGGTGACTGTGGACTGCGCGCGCGCCCAGTGCTGCATCCAGAACCCGGGCGCCGCCGACGAGCCGCCCAAGCAGTTCACCTTCGACGGCGCCTACCACGTGGACCACGTCACCGAGCAGATCTACAACGAGATCGCCTATCCGCTGGTGGAGGGCGTCACTGAGGGCTACAATGGCACCATCTTTGCCTACGGCCAGACAGGCAGCGGGAAGTCCTTCACCATGCAGGGCCTGCCGGATCCGCCCTCCCAGAGAGGCATCATCCCCAGGGCCTTCGAGCACGTGTTCGAGAGCGTCCAGTGTGCAGAGAACACTAAGTTCCTGGTCCGGGCCTCCTACCTGGAGATCTACAATGAAGATGTCCGGGACCTCCTTGGGGCTGACACCAAGCAGAAGCTGGAGCTGAAGGAGCACCCAGAGAAGGGCGTGTACGTGAAGGGGCTGTCCATGCACACGGTGCACAGCGTGGCCCAGTGTGAGCACATCATGGAGACTGGCTGGAAGAACCGTTCGGTCGGCTACACGCTGATGAACAAGGATTCCTCACGCTCGCACTCCATCTTCACCATCAGCATCGAGATGTCTGCCGTGGATGAGCGGGGCAAGGACCACCTCCGGGCGGGCAAGCTGAACCTGGTGGACCTGGCGGGCAGCGAGCGGCAGTCCAAGACCGGGGCCACGGGCGAGCGGCTCAAGGAGGCCACCAAGATCAACCTGTCGCTCTCGGCACTGGGCAATGTCATCTCGGCGCTGGTGGACGGGCGCTGTAAGCACGTCCCCTACCGTGACTCGAAGCTGACGCGGCTGCTGCAGGACTCACTGGGCGGCAACACCAAGACGCTCATGGTGGCCTGCCTGTCGCCTGCGGACAACAACTACGATGAGACACTCAGCACGCTGCGCTACGCCAACCGGGCCAAGAACATCAGGAACAAGCCGCGCATCAATGAGGACCCCAAGGATGCGCTGCTTCGCGAGTACCAGGAGGAGATCAAGAAGCTCAAGGCCATCCTGACACAGCAGATGAGCCCCAGCAGCCTGTCAGCCCTGCTGTCCAGGCAGGTGCCCCCAGACCCTGTGCAGGTGGAGGAGAAGCTGTTGCCCCAACCTGTGATCCAGCATGACATGGAGGCCGAGAAGCAGCTGATCCGGGAGGAGTATGAAGAGCGCCTGGCCCGGCTGAAAGCCGACTATAAGGCCGAGCAGGAGTCTCGGGCCAGGCTGGAGGAAGACATCACTGCCATGCGCAACTCATATGACGTCAGGCTGTCCACGCTGGAGGAGAACCTGCGGAAGGAGACAGAGGCTGTCCTGCAGGTGGGAGTCCTCTACAAGGCTGAGGTCATGTCCAGGGCTGAGTTTGCCAGCAGCGCTGAGTACCCGCCTGCTTTTCAGTATGAGACAGTGGTGAAACCCAAGGTCTTCTCCACGACTGACACTCTGCCCAGTGACGATGTCTCCAAGACTCAGGTTTCCTCCAGGTTTGCGGAGCTGCCCAAGGTGGAACCCTCCAAATCTGAGATTTCTCTGGGCTCCAGTGAGTCATCCTCGCTCGAAGAAACCTCTGTGTCCGAGGCTTTCCCTGGGCCTGAGGAGCCCTCCAACGTGGAGGTCTCCATGCCCACTGAGGAGTCCAGGAGCAGATACTTCCTGGATGAGTGCCTCGGGCAGGAGGCCGCTGGGCACCTGCTGGGGGAACAGAACTACCTCCCGCAAGAGGAGCCGCAGGAGGTGCCCCTGCAGGGGTTACTAGGCCTGCAGGACCCGTTTGCCGAGGTGGAAGCCAAGCTGGCCAGACTCTCCTCCACCGTGGCCAGGACAGATGCACCCCAGGCAGACGTCCCCAAGGTCCCTGTGCAGGTCCCTGCGCCGACAGACCTGCTGGAGCCCAGTGATGCCAGGCCCGAAGCCGAGGCGGCTGATGACTTCCCGCCCAGGCCTGAGGTAGATCTGGCCTCGGAAGTGGCCTTAGAGGTGGTGCGGACAGCAGAGCCTGGCGTGTGGTTGGAGGCTCAGGCCCCGGTGGCCCTGGTGGCTCAGCCTGAGCCCCTGCCGGCCACAGCTGGTGTGAAGAGGGAGAGCGTGGGCATGGAGGTGGCAGTGCTGACTGATGACCCGCTGCCCGTTGTGGACCAGCAGCAGGTGCTGGCCCGTCTGCAGCTGTTGGAGCAGCAGGTTGTGGGTGGAGAGCAGGCCAAGAACAAGGACCTGAAGGAGAAGCACAAGCGGCGCAAGCGCTACGCAGACGAGCGCAGGAAGCAGCTGGTGGCTGCCCTGCAGAACTCGGATGAGGACAGCGGGGACTGGGTGCTGCTTAACGTCTACGACTCCATCCAGGAGGAAGTGCGGGCCAAGAGCAAGCTGCTGGAGAAGATGCAGAGGAAGCTTCGGGCAGCAGAGGTGGAGATCAAAGATCTGCAGTCCGAGTTTCAGCTGGAGAAGATCGATTACTTGGCCACCATCCGCCGGCAGGAGCGTGACTCCATGCTCTTGCAGCAGCTCCTGGAGCAGGTGCAGCCCCTGATTCGCAGGGACTGTAACTACAGCAACCTGGAGAAGATTCTGCGTGAGTCCTGCTGGGACGAAGATAACGGCTTCTGGAAGATCCCACATCCCGTCATCACAAAAACCAGCCTCCCAGTAGTTTCAACTGGGCCACAGAACAAACCAGCCCGCAAAACCTCTGCAGCAGACAATGGCGAGCCGAACATGGAGGAGGACCGCTACAGGCTCATGCTCAGTCGGAGCAACAGTGAAAACATTGCCAGCAACTACTTCCGATCTAAGCGGGCCAGCCAGATCCTCAGCACAGACGCCAGGAAGAGCCTCACACATCACAACTCGCCACCAGGCCTCAGCTGCCCACTCAGCAACAACTCTGCCATCCCACCCACCCAGGCCCCTGAAATGCCCCAGCCCCGGCCCTTCCGCCTCGAGTCCCTCGACATCCCTTTCACCAAGGCCAAGCGTAAGAAAAGCAAAAGCAACTTTGGCAGTGAGCCTCTGTGAGCACAGCTGCTTGCCATTGCCTGCCTTATAGGCATGTAGAGACTGCCAGGCCCTCCCAGGGCAGCCCCAACCAGGTCTCCTCCCACCTGCCACACAGCGCTCCGGGGCCTGAGGGCTCCCTCAGCCCTGGGAAGACACATTCCCTTCCCTGTTCCCCAGAGAGCCCACCTCTGCCCTGGGCAGGAGCCCCTCGGAGGCTGTATAGTCCTCCTTAGAGAGGCCTGCTCCAGCTGTTCATACCACATCAGTGTTTCCGTCTGCTCACCTGCCACAGAGCCCACACCCATGCCCACCAGTGTTGGTCTTTGCCTCAAAGCCTGAGACCTGCTTCACGGCCTTCACCAGCCCTGATGGAGAGGGCAGCAGCTGCCACGTGGAGGAAGCTCAATATCAGCTGGGAAGGAACTGTGCCTCTGTCTGACTGGCCCCACTTCCTAAGCACTGCCCTGCCCCATGGGGTGGCACAGGGGTCCCACAGCAGGTCTTCCTGCACTGCCCACCCCTGGCTGGTCTGTGGCCCAAGGAAGGCCACTCCACATTAAGCTGCCCAATAAACTGCTTTTAAGATAAAAAAAAAAAAAAAAAAAGA

Insert Property: Insert 1

Type Value Extra Information
CDS Start 75
CDS Stop 3161

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

AGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGAGCTTGCAATTCGCGCGTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTAGTACGAGGCCCTTTCACTCATTAGATGCATGTCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGGACTCTAGCCTAGGCCGCGGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATTAGGCCTATTTAGGTGACACTATAGAACAAGTTTGTACAAAAAAGCAGGCTGGTACCGGTCCGGAATTCCCGGGATATCGTCGACCCACGCGTCCGCTTGGCCCGGGCTGCTGGGAGTCCCCGGCGGGGCGGGGGTCAGCTCTGGTCCCGGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTCCCATGAACCAGCGGGAGCGAGAGCTGCGCTGCCAGCCCGTGGTGACTGTGGACTGCGCGCGCGCCCAGTGCTGCATCCAGAACCCGGGCGCCGCCGACGAGCCGCCCAAGCAGTTCACCTTCGACGGCGCCTACCACGTGGACCACGTCACCGAGCAGATCTACAACGAGATCGCCTATCCGCTGGTGGAGGGCGTCACTGAGGGCTACAATGGCACCATCTTTGCCTACGGCCAGACAGGCAGCGGGAAGTCCTTCACCATGCAGGGCCTGCCGGATCCGCCCTCCCAGAGAGGCATCATCCCCAGGGCCTTCGAGCACGTGTTCGAGAGCGTCCAGTGTGCAGAGAACACTAAGTTCCTGGTCCGGGCCTCCTACCTGGAGATCTACAATGAAGATGTCCGGGACCTCCTTGGGGCTGACACCAAGCAGAAGCTGGAGCTGAAGGAGCACCCAGAGAAGGGCGTGTACGTGAAGGGGCTGTCCATGCACACGGTGCACAGCGTGGCCCAGTGTGAGCACATCATGGAGACTGGCTGGAAGAACCGTTCGGTCGGCTACACGCTGATGAACAAGGATTCCTCACGCTCGCACTCCATCTTCACCATCAGCATCGAGATGTCTGCCGTGGATGAGCGGGGCAAGGACCACCTCCGGGCGGGCAAGCTGAACCTGGTGGACCTGGCGGGCAGCGAGCGGCAGTCCAAGACCGGGGCCACGGGCGAGCGGCTCAAGGAGGCCACCAAGATCAACCTGTCGCTCTCGGCACTGGGCAATGTCATCTCGGCGCTGGTGGACGGGCGCTGTAAGCACGTCCCCTACCGTGACTCGAAGCTGACGCGGCTGCTGCAGGACTCACTGGGCGGCAACACCAAGACGCTCATGGTGGCCTGCCTGTCGCCTGCGGACAACAACTACGATGAGACACTCAGCACGCTGCGCTACGCCAACCGGGCCAAGAACATCAGGAACAAGCCGCGCATCAATGAGGACCCCAAGGATGCGCTGCTTCGCGAGTACCAGGAGGAGATCAAGAAGCTCAAGGCCATCCTGACACAGCAGATGAGCCCCAGCAGCCTGTCAGCCCTGCTGTCCAGGCAGGTGCCCCCAGACCCTGTGCAGGTGGAGGAGAAGCTGTTGCCCCAACCTGTGATCCAGCATGACATGGAGGCCGAGAAGCAGCTGATCCGGGAGGAGTATGAAGAGCGCCTGGCCCGGCTGAAAGCCGACTATAAGGCCGAGCAGGAGTCTCGGGCCAGGCTGGAGGAAGACATCACTGCCATGCGCAACTCATATGACGTCAGGCTGTCCACGCTGGAGGAGAACCTGCGGAAGGAGACAGAGGCTGTCCTGCAGGTGGGAGTCCTCTACAAGGCTGAGGTCATGTCCAGGGCTGAGTTTGCCAGCAGCGCTGAGTACCCGCCTGCTTTTCAGTATGAGACAGTGGTGAAACCCAAGGTCTTCTCCACGACTGACACTCTGCCCAGTGACGATGTCTCCAAGACTCAGGTTTCCTCCAGGTTTGCGGAGCTGCCCAAGGTGGAACCCTCCAAATCTGAGATTTCTCTGGGCTCCAGTGAGTCATCCTCGCTCGAAGAAACCTCTGTGTCCGAGGCTTTCCCTGGGCCTGAGGAGCCCTCCAACGTGGAGGTCTCCATGCCCACTGAGGAGTCCAGGAGCAGATACTTCCTGGATGAGTGCCTCGGGCAGGAGGCCGCTGGGCACCTGCTGGGGGAACAGAACTACCTCCCGCAAGAGGAGCCGCAGGAGGTGCCCCTGCAGGGGTTACTAGGCCTGCAGGACCCGTTTGCCGAGGTGGAAGCCAAGCTGGCCAGACTCTCCTCCACCGTGGCCAGGACAGATGCACCCCAGGCAGACGTCCCCAAGGTCCCTGTGCAGGTCCCTGCGCCGACAGACCTGCTGGAGCCCAGTGATGCCAGGCCCGAAGCCGAGGCGGCTGATGACTTCCCGCCCAGGCCTGAGGTAGATCTGGCCTCGGAAGTGGCCTTAGAGGTGGTGCGGACAGCAGAGCCTGGCGTGTGGTTGGAGGCTCAGGCCCCGGTGGCCCTGGTGGCTCAGCCTGAGCCCCTGCCGGCCACAGCTGGTGTGAAGAGGGAGAGCGTGGGCATGGAGGTGGCAGTGCTGACTGATGACCCGCTGCCCGTTGTGGACCAGCAGCAGGTGCTGGCCCGTCTGCAGCTGTTGGAGCAGCAGGTTGTGGGTGGAGAGCAGGCCAAGAACAAGGACCTGAAGGAGAAGCACAAGCGGCGCAAGCGCTACGCAGACGAGCGCAGGAAGCAGCTGGTGGCTGCCCTGCAGAACTCGGATGAGGACAGCGGGGACTGGGTGCTGCTTAACGTCTACGACTCCATCCAGGAGGAAGTGCGGGCCAAGAGCAAGCTGCTGGAGAAGATGCAGAGGAAGCTTCGGGCAGCAGAGGTGGAGATCAAAGATCTGCAGTCCGAGTTTCAGCTGGAGAAGATCGATTACTTGGCCACCATCCGCCGGCAGGAGCGTGACTCCATGCTCTTGCAGCAGCTCCTGGAGCAGGTGCAGCCCCTGATTCGCAGGGACTGTAACTACAGCAACCTGGAGAAGATTCTGCGTGAGTCCTGCTGGGACGAAGATAACGGCTTCTGGAAGATCCCACATCCCGTCATCACAAAAACCAGCCTCCCAGTAGTTTCAACTGGGCCACAGAACAAACCAGCCCGCAAAACCTCTGCAGCAGACAATGGCGAGCCGAACATGGAGGAGGACCGCTACAGGCTCATGCTCAGTCGGAGCAACAGTGAAAACATTGCCAGCAACTACTTCCGATCTAAGCGGGCCAGCCAGATCCTCAGCACAGACGCCAGGAAGAGCCTCACACATCACAACTCGCCACCAGGCCTCAGCTGCCCACTCAGCAACAACTCTGCCATCCCACCCACCCAGGCCCCTGAAATGCCCCAGCCCCGGCCCTTCCGCCTCGAGTCCCTCGACATCCCTTTCACCAAGGCCAAGCGTAAGAAAAGCAAAAGCAACTTTGGCAGTGAGCCTCTGTGAGCACAGCTGCTTGCCATTGCCTGCCTTATAGGCATGTAGAGACTGCCAGGCCCTCCCAGGGCAGCCCCAACCAGGTCTCCTCCCACCTGCCACACAGCGCTCCGGGGCCTGAGGGCTCCCTCAGCCCTGGGAAGACACATTCCCTTCCCTGTTCCCCAGAGAGCCCACCTCTGCCCTGGGCAGGAGCCCCTCGGAGGCTGTATAGTCCTCCTTAGAGAGGCCTGCTCCAGCTGTTCATACCACATCAGTGTTTCCGTCTGCTCACCTGCCACAGAGCCCACACCCATGCCCACCAGTGTTGGTCTTTGCCTCAAAGCCTGAGACCTGCTTCACGGCCTTCACCAGCCCTGATGGAGAGGGCAGCAGCTGCCACGTGGAGGAAGCTCAATATCAGCTGGGAAGGAACTGTGCCTCTGTCTGACTGGCCCCACTTCCTAAGCACTGCCCTGCCCCATGGGGTGGCACAGGGGTCCCACAGCAGGTCTTCCTGCACTGCCCACCCCTGGCTGGTCTGTGGCCCAAGGAAGGCCACTCCACATTAAGCTGCCCAATAAACTGCTTTTAAGATAAAAAAAAAAAAAAAAAAAGAGGGCGGCCGCTCTAGAGTATCCCTCGAGGGGCCCAAGCTTACGCGTACCCAGCTTTCTTGTACAAAGTGGTCCCTATAGTGAGTCGTATTATAAGCTAGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACTGCTAGCTTGGGATCTTTGTGAAGGAACCTTACTTCTGTGGTGTGACATAATTGGACAAACTACCTACAGAGATTTAAAGCTCTAAGGTAAATATAAAATTTTTAAGTGTATAATGTGTTAAACTAGCTGCATATGCTTGCTGCTTGAGAGTTTTGCTTACTGAGTATGATTTATGAAAATATTATACACAGGAGCTAGTGATTCTAATTGTTTGTGTATTTTAGATTCACAGTCCCAAGGCTCATTTCAGGCCCCTCAGTCCTCACAGTCTGTTCATGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCGATCCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGCCAGGTCTTGGACTGGTGAGAACGGCTTGCTCGGCAGCTTCGATGTGTGCTGGAGGGAGAATAAAGGTCTAAGATGTGCGATAGAGGGAAGTCGCATTGAATTATGTGCTGTGTAGGGATCGCTGGTATCAAATATGTGTGCCCACCCCTGGCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGCCATAACTTCGTATAATGTATGCTATACGAAGTTATGGCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAA

Sequencing Information:

Phred Score: 894
Date: 2016-07-15

Last Passing Sequencing Read:

>25606-28_HsCD00339613-CMV-F_D4 894 1553 35 985 NTTTTTNCGTGGACATANCGACTCGTTAGTGACCGTCAGATCGCCTGGAG ACCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAG CCTCCGGACTCTAGCCTAGGCCGCGGGACGGATAACAATTTCACACAGGA AACAGCTATGACCATTAGGCCTATTTAGGTGACACTATAGAACAAGTTTG TACAAAAAAGCAGGCTGGTACCGGTCCGGAATTCCCGGGATATCGTCGAC CCACGCGTCCGCTTGGCCCGGGCTGCTGGGAGTCCCCGGCGGGGCGGGGG TCAGCTCTGGTCCCGGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCG GTGAAGGTTGTCGTGCGCTGCCGTCCCATGAACCAGCGGGAGCGAGAGCT GCGCTGCCAGCCCGTGGTGACTGTGGACTGCGCGCGCGCCCAGTGCTGCA TCCAGAACCCGGGCGCCGCCGACGAGCCGCCCAAGCAGTTCACCTTCGAC GGCGCCTACCACGTGGACCACGTCACCGAGCAGATCTACAACGAGATCGC CTATCCGCTGGTGGAGGGCGTCACTGAGGGCTACAATGGCACCATCTTTG CCTACGGCCAGACAGGCAGCGGGAAGTCCTTCACCATGCAGGGCCTGCCG GATCCGCCCTCCCAGAGAGGCATCATCCCCAGGGCCTTCGAGCACGTGTT CGAGAGCGTCCAGTGTGCAGAGAACACTAAGTTCCTGGTCCGGGCCTCCT ACCTGGAGATCTACAATGAAGATGTCCGGGACCTCCTTGGGGCTGACACC AAGCAGAAGCTGGAGCTGAAGGAGCACCCAGAGAAGGGCGTGTACGTGAA GGGGCTGTCCATGCACACGGTGCACAGCGTGGCCCAGTGTGAGCACATCA TGGAGACTGGCTGGAAGAACGNTNNCGTCGCTACACGCTGATGAACAAGG ATTCTCACGCTCGCACTCCATCTTTCACATCAGCATCGAGATGTCTGCCG TGGATGAGCGGGGCAAGGACCACCTCGGGCGGNCAGCTGAACCTGTGGNA CTGNCGGGCACGAGCGGCAGTCCAGACCNGGGCCACGGCGAGCGCTCAGG GANGGCACAGGATCACTGTCGCTCTCGCACTGGCATGTCTCTCGCGCTGG TGACGCGCTGTAGCCGTCCCTACGTGACCGAGCTGACCGCTGCTGAGATC ATGGGCGCACACAGACCTCATGTGCTGCCTGCCTGCGAAAAATCAATGAA CTACCGTGCTTGCACGGGCAAATNGGAAACCGCTCTGAGACAAGGGCCGT TCCGACCAAGAAAAATTAGCTCTTAAAAAGACCCACTTCCCGTTGGGGCC ACCGTGGGGGAAGTTCCCTTTCCTGGGCAAATATCGGAAAAGGCGGCCAA AAAAGAGGGGAAAGCACATTCCCCAAAAAGGAGAGGGGGGGGNNNNNNNN NNTCTTCNNTCAATNNNNGCGCTGCGGCCCCGGGGGNNNNNNNNGGNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Vector Information:

Vector Name:pCMV-SPORT6
Type:bacterial plasmid
Description:Clone with T7, SP6, and CMV promoters and LoxP site. ampicillin resistance in bacteria
Properties:loxP
Comments:An MluI site is introduced upon ligation of a cDNA insert. "pCMV-SPORT6 Library Method Overview: Prior to January 2001, Life Technologies, Invitrogen Corp., Carlsbad, CA, constructed non-normalized (standard) libraries in the pCMV-SPORT6 vector. Briefly, the library method was as follows: First strand cDNA was synthesized from polyA+mRNA using Invitrogen Superscript II RT and an oligo-dT primer containing a Not I site. Second strand cDNA was synthesized. Sal I adapters were ligated onto the double stranded cDNA which was then digested with Not I creating 5'-Sal I/3'- Not I inserts. This cDNA was size-fractionated on a column and ligated into the pCMV-Sport6 vector." http://mgc.nci.nih.gov/Vectors/prot_pcmv-sport6
Map:pcmv-sport6.gif
Sequence:pCMV_Sport_6.txt
Size (bp):4396
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
MGC Consortium