Clone: HsCD00337483

Clone ID:HsCD00337483
Is Verified:Y
Status:AVAILABLE
Source:MGC
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

IMAGE ID 5300334
GI 38173805
GenBank Accession BC060838
Original Clone ID MGC:71732

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 3720 Homo sapiens CLOSED 405 ARNT aryl hydrocarbon receptor nuclear translocator
Insert1
Size (bp)3720
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 405
Gene SymbolARNT
Gene Namearyl hydrocarbon receptor nuclear translocator
Keyword

Insert Sequence:

GGGTTCCGCGGTAGCGGAGGCGGCGGTCAGGCGCCGCTTCTGGGGAGTGGCCTTTCTTTTCCCCTCCCTCCCGGTTCGGTGGCGGCGGCTCCTCCCACTGGGGGGGGGTGGCGCGGCGGCGGTGGCATCTGCGGCCATGGCGGCGACTACTGCCAACCCCGAAATGACATCAGATGTACCATCACTGGGTCCAGCCATTGCCTCTGGAAACTCTGGACCTGGAATTCAAGGTGGAGGAGCCATTGTCCAGAGGGCTATTAAGCGGCGACCAGGGCTGGATTTTGATGATGATGGAGAAGGGAACAGTAAATTTTTGAGGTGTGATGATGATCAGATGTCTAACGATAAGGAGCGGTTTGCCAGGTCGGATGATGAGCAGAGCTCTGCGGATAAAGAGAGACTTGCAAGGGAAAATCACAGTGAAATTGAACGGCGGCGACGGAACAAGATGACAGCCTACATCACAGAACTGTCAGATATGGTACCCACATGTAGTGCCCTGGCTCGAAAACCAGACAAGCTAACCATCTTACGCATGGCAGTTTCTCACATGAAGTCCTTGCGGGGAACTGGCAACACATCCACTGATGGCTCCTATAAGCCGTCTTTCCTCACTGATCAGGAACTGAAACATTTGATCTTGGAGGCAGCAGATGGCTTTCTGTTTATTGTCTCATGTGAGACAGGCAGGGTGGTGTATGTCTCTGACTCCGTGACTCCTGTTTTGAACCAGCAACAGTCTGAATGGTTTGGCAGCACACTCTATGATCAGGTGCACCCAGATGATGTGGATAAACTTCGTGAGCAGCTTTCCACTTCAGAAAATGCCCTGACAGGGCGTATCCTGGATCTAAAGACTGGAACAGTGAAAAAGGAAGGTCAGCAGTCTTCCATGAGAATGTGTATGGGCTCAAGGAGATCGTTTATTTGCCGAATGAGGTGTGGCAGTAGCTCTGTGGACCCAGTTTCTGTGAATAGGCTGAGCTTTGTGAGGAACAGATGCAGGAATGGACTTGGCTCTGTAAAGGATGGGGAACCTCACTTCGTGGTGGTCCACTGCACAGGCTACATCAAGGCCTGGCCCCCAGCAGGTGTTTCCCTCCCAGATGATGACCCAGAGGCTGGCCAGGGAAGCAAGTTTTGCCTAGTGGCCATTGGCAGATTGCAGGTAACTAGTTCTCCCAACTGTACAGACATGAGTAATGTTTGTCAACCAACAGAGTTAATCTCCCGACACAACATTGAGGGTATCTTCACTTTTGTGGATCACCGCTGTGTGGCTACTGTTGGCTACCAGCCACAGGAACTCTTAGGAAAGAATATTGTAGAATTCTGTCATCCTGAAGACCAGCAGCTTCTAAGAGACAGCTTCCAACAGGAACTCTAGCCAAGAACCACGGCCTACACTCTCCAACACAATCCAGAGGCCACAACTAGGTCCCACAGCTAATTTACCCCTGGAGATGGGCTCAGGACAGCTGCCTACCCTAGTCTCACCAATCGTGGATCTAACTTTGCTCCTGAGACTGGACAGACTGCAGGACAATTCCAGACACGGACAGCAGAGGGTGTGGGTGTCTGGCCACAGTGGCAGGGCCAGCAGCCTCATCATCGTTCAAGTTCTAGTGAGCAACATGTTCAACAACCGCCAGCACAGCAACCTGGCCAGCCTGAGGTCTTCCAGGAGATGCTGTCCATGCTGGGAGATCAGAGCAACAGCTACAACAATGAAGAATTCCCTGATCTAACTATGTTTCCCCCCTTTTCAGAATAGAACTATTGGGGTGAGGATAAGGGGTGGGGGAGAAAAAATCACTGTTTGTTTTTAAAAAGCAAATCTTTCTGTAAACAGAATAAAAGTTCCTCTCCCTTCCCTTCCCTCACCCCTGACATGTACCCCCTTTCCCTTCTGGCTGTTCCCCTGCTCTGTTGCCTCTCTAAGGTAACATTTATAGAAGAAATGGAATGAATCTCCAAGGCTTTTAGGACTGTCTGAAAATTTGAGGCTGGGTGAAGTTATAACACCTTTCCTTATGTCTCCTGACCTGAAATTGTATAGTGTTGATTTGTGCTGAGATCAAGAGGCAGGTTAGAAGAACCTGACATCCACTGTTTGCCTTGGATAGTATGGCTTGTTTTTGGAAAGAAATTCTGAAGAGAGTGGAGGAGAGGAGAGATGTCCTCATATTTGAGGACCATGAAACATTGTAGGTATATATGGGGCTTTAGCAAGTTTGAGCATAGGCTCTTTTTGCTGCCTGTGAGCAGTCCCTCTGGAAAGAAACGTGTGAGTAAGTGAGAGAGAGTGTGTGTGTATGTGTGTGTGTGTGTGTGTGTGTGCGCACACATGCTTCTGTATTTCACTCTTTCTCCCTATTAGGGAGTTATGCAAAATTTGTCCCCGATTTTACCTTTGTCTTTCTGTGTACTTTTCAAAGAGTCCTAAGGAGTTAAATCTTCCAGGTATTTTCCACTTAGTATTGCAGCCAAAGAATATTTAAATAAACGTCTTTGCTGCGCTTGCATCCATGCCCAGCCAATATACAACTGTAAAGCAAATATAGAAAGTCGGCTGTTGATACGATTGTCTGTTATCGAACACATTCAGTGATAAAGCTGGGTTACTGCTGCTTTTGGTGCTCTCACGTTATCTGGAAGATCTGCAAACATTACCTAAATAGGCTGGCAAGATAAACACTTTCTGGAACCCGAGACTTGGCCATAAAGATAATGCTGCATTTTTCTGTCAGAATCACATATGATGTGTGTTCTGTAGAGGTTATTTCTGCATGGAAACTCAACTTCTTGGATTAGCCGTCCCAGTGAAAATCCTCATTGTTGGAGTGTAAACCAAATACGAAGCCCTCTTGCAAAGTAGCCTCTTTCATCCCATACTCAAAATACCAAGTTTAGCAAGCAACTGAGATTTAAGTCTCTCTGGCCCTAAGAGGTTTTTCCTCTTTGCTCCCTCCAATCTTGAGATTGGGTTTTGCTTTAGAGTGCAAGTATCATAATTCCGTATGATAGATGGGGCCTGGACACACATCTCAACAGGGTCACTTGGTAATTAACAATAGCCATATAAATGCGGATACAGGTTACTACCCTCACCCTTTACCTTCCTCAGGTAACAGTCGTAGATACCAGCTTTTTTTTTTTTTTTTTTTTTAAATTGGCTTTGGCCAGTAGCTAAAGTGCAAGACTGAATTAATGAGAAGATATATTAAATGTAGTCATAGGGGACTGAGGAGCAAGGGTGGCCTTGAAGAGGCCAAAGGAATGTCCATTTGCTGAGTTTCCCTTCCTTATGTCTCCAGTCTGGTGCCAGGTAGTGGAGTAAAAAAGGAGACAGTTTATTTTTTTATTCTATGTGCACACTTACAGTATACATATATATTTATATCACAATTTACGAAACCAAAAAGTTGAGTTTCCAATGGAACCCTTGTTTTTTAATAATCGACTTTTTAAATGTGATCAGGACTATAATATTGTACAGTTATTATAGGGCTTTTGGGGAAGGGGAGGATAGCGAGAAGATGCTCTGGGGGTTTTGTTTTTGCTTTTCCTTCAGGGTTTTATTTTTGACTGTTTTGTTTTCTTGTTGGCCATTTCTGTATTGCTGGCATCTGTGCTAAGCTTTACAGTGGCAAAAATAATGACATGTAGCAAAGATTTTCAAACAAAATATTTTTTCCTTTTGCAAAAAAAAAAAAAAAA

Insert Property: Insert 1

Type Value Extra Information
CDS Start 137
CDS Stop 1387

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

GCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGAGCTCCACCGCGGTGGCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATGGATCAGGCCAAATCGGCCGAGCTCGAATTCGTCGAGAGCGGGGGTTCCGCGGTAGCGGAGGCGGCGGTCAGGCGCCGCTTCTGGGGAGTGGCCTTTCTTTTCCCCTCCCTCCCGGTTCGGTGGCGGCGGCTCCTCCCACTGGGGGGGGGTGGCGCGGCGGCGGTGGCATCTGCGGCCATGGCGGCGACTACTGCCAACCCCGAAATGACATCAGATGTACCATCACTGGGTCCAGCCATTGCCTCTGGAAACTCTGGACCTGGAATTCAAGGTGGAGGAGCCATTGTCCAGAGGGCTATTAAGCGGCGACCAGGGCTGGATTTTGATGATGATGGAGAAGGGAACAGTAAATTTTTGAGGTGTGATGATGATCAGATGTCTAACGATAAGGAGCGGTTTGCCAGGTCGGATGATGAGCAGAGCTCTGCGGATAAAGAGAGACTTGCAAGGGAAAATCACAGTGAAATTGAACGGCGGCGACGGAACAAGATGACAGCCTACATCACAGAACTGTCAGATATGGTACCCACATGTAGTGCCCTGGCTCGAAAACCAGACAAGCTAACCATCTTACGCATGGCAGTTTCTCACATGAAGTCCTTGCGGGGAACTGGCAACACATCCACTGATGGCTCCTATAAGCCGTCTTTCCTCACTGATCAGGAACTGAAACATTTGATCTTGGAGGCAGCAGATGGCTTTCTGTTTATTGTCTCATGTGAGACAGGCAGGGTGGTGTATGTCTCTGACTCCGTGACTCCTGTTTTGAACCAGCAACAGTCTGAATGGTTTGGCAGCACACTCTATGATCAGGTGCACCCAGATGATGTGGATAAACTTCGTGAGCAGCTTTCCACTTCAGAAAATGCCCTGACAGGGCGTATCCTGGATCTAAAGACTGGAACAGTGAAAAAGGAAGGTCAGCAGTCTTCCATGAGAATGTGTATGGGCTCAAGGAGATCGTTTATTTGCCGAATGAGGTGTGGCAGTAGCTCTGTGGACCCAGTTTCTGTGAATAGGCTGAGCTTTGTGAGGAACAGATGCAGGAATGGACTTGGCTCTGTAAAGGATGGGGAACCTCACTTCGTGGTGGTCCACTGCACAGGCTACATCAAGGCCTGGCCCCCAGCAGGTGTTTCCCTCCCAGATGATGACCCAGAGGCTGGCCAGGGAAGCAAGTTTTGCCTAGTGGCCATTGGCAGATTGCAGGTAACTAGTTCTCCCAACTGTACAGACATGAGTAATGTTTGTCAACCAACAGAGTTAATCTCCCGACACAACATTGAGGGTATCTTCACTTTTGTGGATCACCGCTGTGTGGCTACTGTTGGCTACCAGCCACAGGAACTCTTAGGAAAGAATATTGTAGAATTCTGTCATCCTGAAGACCAGCAGCTTCTAAGAGACAGCTTCCAACAGGAACTCTAGCCAAGAACCACGGCCTACACTCTCCAACACAATCCAGAGGCCACAACTAGGTCCCACAGCTAATTTACCCCTGGAGATGGGCTCAGGACAGCTGCCTACCCTAGTCTCACCAATCGTGGATCTAACTTTGCTCCTGAGACTGGACAGACTGCAGGACAATTCCAGACACGGACAGCAGAGGGTGTGGGTGTCTGGCCACAGTGGCAGGGCCAGCAGCCTCATCATCGTTCAAGTTCTAGTGAGCAACATGTTCAACAACCGCCAGCACAGCAACCTGGCCAGCCTGAGGTCTTCCAGGAGATGCTGTCCATGCTGGGAGATCAGAGCAACAGCTACAACAATGAAGAATTCCCTGATCTAACTATGTTTCCCCCCTTTTCAGAATAGAACTATTGGGGTGAGGATAAGGGGTGGGGGAGAAAAAATCACTGTTTGTTTTTAAAAAGCAAATCTTTCTGTAAACAGAATAAAAGTTCCTCTCCCTTCCCTTCCCTCACCCCTGACATGTACCCCCTTTCCCTTCTGGCTGTTCCCCTGCTCTGTTGCCTCTCTAAGGTAACATTTATAGAAGAAATGGAATGAATCTCCAAGGCTTTTAGGACTGTCTGAAAATTTGAGGCTGGGTGAAGTTATAACACCTTTCCTTATGTCTCCTGACCTGAAATTGTATAGTGTTGATTTGTGCTGAGATCAAGAGGCAGGTTAGAAGAACCTGACATCCACTGTTTGCCTTGGATAGTATGGCTTGTTTTTGGAAAGAAATTCTGAAGAGAGTGGAGGAGAGGAGAGATGTCCTCATATTTGAGGACCATGAAACATTGTAGGTATATATGGGGCTTTAGCAAGTTTGAGCATAGGCTCTTTTTGCTGCCTGTGAGCAGTCCCTCTGGAAAGAAACGTGTGAGTAAGTGAGAGAGAGTGTGTGTGTATGTGTGTGTGTGTGTGTGTGTGTGCGCACACATGCTTCTGTATTTCACTCTTTCTCCCTATTAGGGAGTTATGCAAAATTTGTCCCCGATTTTACCTTTGTCTTTCTGTGTACTTTTCAAAGAGTCCTAAGGAGTTAAATCTTCCAGGTATTTTCCACTTAGTATTGCAGCCAAAGAATATTTAAATAAACGTCTTTGCTGCGCTTGCATCCATGCCCAGCCAATATACAACTGTAAAGCAAATATAGAAAGTCGGCTGTTGATACGATTGTCTGTTATCGAACACATTCAGTGATAAAGCTGGGTTACTGCTGCTTTTGGTGCTCTCACGTTATCTGGAAGATCTGCAAACATTACCTAAATAGGCTGGCAAGATAAACACTTTCTGGAACCCGAGACTTGGCCATAAAGATAATGCTGCATTTTTCTGTCAGAATCACATATGATGTGTGTTCTGTAGAGGTTATTTCTGCATGGAAACTCAACTTCTTGGATTAGCCGTCCCAGTGAAAATCCTCATTGTTGGAGTGTAAACCAAATACGAAGCCCTCTTGCAAAGTAGCCTCTTTCATCCCATACTCAAAATACCAAGTTTAGCAAGCAACTGAGATTTAAGTCTCTCTGGCCCTAAGAGGTTTTTCCTCTTTGCTCCCTCCAATCTTGAGATTGGGTTTTGCTTTAGAGTGCAAGTATCATAATTCCGTATGATAGATGGGGCCTGGACACACATCTCAACAGGGTCACTTGGTAATTAACAATAGCCATATAAATGCGGATACAGGTTACTACCCTCACCCTTTACCTTCCTCAGGTAACAGTCGTAGATACCAGCTTTTTTTTTTTTTTTTTTTTTAAATTGGCTTTGGCCAGTAGCTAAAGTGCAAGACTGAATTAATGAGAAGATATATTAAATGTAGTCATAGGGGACTGAGGAGCAAGGGTGGCCTTGAAGAGGCCAAAGGAATGTCCATTTGCTGAGTTTCCCTTCCTTATGTCTCCAGTCTGGTGCCAGGTAGTGGAGTAAAAAAGGAGACAGTTTATTTTTTTATTCTATGTGCACACTTACAGTATACATATATATTTATATCACAATTTACGAAACCAAAAAGTTGAGTTTCCAATGGAACCCTTGTTTTTTAATAATCGACTTTTTAAATGTGATCAGGACTATAATATTGTACAGTTATTATAGGGCTTTTGGGGAAGGGGAGGATAGCGAGAAGATGCTCTGGGGGTTTTGTTTTTGCTTTTCCTTCAGGGTTTTATTTTTGACTGTTTTGTTTTCTTGTTGGCCATTTCTGTATTGCTGGCATCTGTGCTAAGCTTTACAGTGGCAAAAATAATGACATGTAGCAAAGATTTTCAAACAAAATATTTTTTCCTTTTGCAAAAAAAAAAAAAAAACTCTCCAGCGCTGGATCCGGCCATAAGGGCCTGATCCGTCGAGGGGGGGCCCGGTACCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTTCGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGCGCCCTGTAGCGGC

Sequencing Information:

Phred Score: 864
Date: 2015-11-06

Last Passing Sequencing Read:

HsCD00418580_CMV-F ATGGCGGCGACTACTGCCAACCCCGAAATGACATCAGATGTACCATCACTGGGTCCAGCCATTGCCTCTGGAAACTCTGGACCTGGAATTCAAGGTGGAGGAGCCATTGTCCAGAGGGCTATTAAGCGGCGACCAGGGCTGGATTTTGATGATGATGGAGAAGGGAACAGTAAATTTTTGAGGTGTGATGATGATCAGATGTCTAACGATAAGGAGCGGTTTGCCAGGTCGGATGATGAGCAGAGCTCTGCGGATAAAGAGAGACTTGCAAGGGAAAATCACAGTGAAATTGAACGGCGGCGACGGAACAAGATGACAGCCTACATCACAGAACTGTCAGATATGGTACCCACATGTAGTGCCCTGGCTCGAAAACCAGACAAGCTAACCATCTTACGCATGGCAGTTTCTCACATGAAGTCCTTGCGGGGAACTGGCAACACATCCACTGATGGCTCCTATAAGCCGTCTTTCCTCACTGATCAGGAACTGAAACATTTGATCTTGGAGGCAGCAGATGGCTTTCTGTTTATTGTCTCATGTGAGACAGGCAGGGTGGTGTATGTCTCTGACTCCGTGACTCCTGTTTTGAACCAGCAACAGTCTGAATGGTTTGGCAGCACACTCTATGATCAGGTGCACCCAGATGATGTGGATAAACTTCGTGAGCAGCTTTCCACTTCAGAAAATGCCCTGACAGGGCGTATCCTGGATCTAAAGACTGGAACAGTGAAAAAGGA

Vector Information:

Vector Name:pBluescriptR
Type:bacterial plasmid
Description:Phagemid cloning system T7 and T3 Promoters M13 forward and M13 reverse sequencing primers Ampicillin resistance in bacterial cultures
Properties:loxP
Comments:Modified pBluescript from Riken.
Map:pBluescriptR.gif
Sequence:pBluescriptR.txt
Size (bp):3178
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
MGC Consortium