Clone: HsCD00332508

Clone ID:HsCD00332508
Is Verified:Y
Status:AVAILABLE
Source:MGC
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

GI 24657599
GenBank Accession BC039152
IMAGE ID 4749611
Original Clone ID MGC:21078

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 1460 Homo sapiens CLOSED 3280 HES1 hairy and enhancer of split 1, (Drosophila)
Insert1
Size (bp)1460
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 3280
Gene SymbolHES1
Gene Namehairy and enhancer of split 1, (Drosophila)
Keyword

Insert Sequence:

CCCCCGTCTACCTCTCTCCTTGGTCCTGGAACAGCGCTACTGATCACCAAGTAGCCACAAAATATAATAAACCCTCAGCACTTGCTCAGTAGTTTTGTGAAAGTCTCAAGTAAAAGAGACACAAACAAAAAATTCTTTTTCGTGAAGAACTCCAAAAATAAAATTCTCTAGAGATAAAAAAAAAAAAAAAAGGAAAATGCCAGCTGATATAATGGAGAAAAATTCCTCGTCCCCGGTAGCAGCCAGTGTCAACACGACACCGGATAAACCAAAGACAGCATCTGAGCACAGAAAGTCATCAAAGCCTATTATGGAGAAAAGACGAAGAGCAAGAATAAATGAAAGTCTGAGCCAGCTGAAAACACTGATTTTGGATGCTCTGAAGAAAGATAGCTCGCGGCATTCCAAGCTGGAGAAGGCGGACATTCTGGAAATGACAGTGAAGCACCTCCGGAACCTGCAGCGGGCGCAGATGACGGCTGCGCTGAGCACAGACCCAAGTGTGCTGGGGAAGTACCGAGCCGGCTTCAGCGAGTGCATGAACGAGGTGACCCGCTTCCTGTCCACGTGCGAGGGCGTTAATACCGAGGTGCGCACTCGGCTGCTCGGCCACCTGGCCAACTGCATGACCCAGATCAATGCCATGACCTACCCCGGGCAGCCGCACCCCGCCTTGCAGGCGCCGCCACCGCCCCCACCGGGACCCGGCGGCCCCCAGCACGCGCCGTTCGCGCCGCCGCCGCCACTCGTGCCCATCCCCGGGGGCGCGGCGCCCCCTCCCGGCGGCGCCCCCTGCAAGCTGGGCAGCCAGGCTGGAGAGGCGGCTAAGGTGTTTGGAGGCTTCCAGGTGGTACCGGCTCCCGATGGCCAGTTTGCTTTCCTCATTCCCAACGGGGCCTTCGCGCACAGCGGCCCTGTCATCCCCGTCTACACCAGCAACAGCGGCACCTCCGTGGGCCCCAACGCAGTGTCACCTTCCAGCGGCCCCTCGCTTACGGCGGACTCCATGTGGAGGCCGTGGCGGAACTGAGGGGGCTCAGGCCACCCCTCCTCCTAAACTCCCCAACCCACCTCTCTTCCCTCCGGACTCTAAACAGGAACTTGAATACTGGGAGAGAAGAGGACTTTTTTGATTAAGTGGTTACTTTGTGTTTTTTTAATTTCTAAGAAGTTACTTTTTGTAGAGAGAGCTGTATTAAGTGACTGACCATGCACTATATTTGTATATATTTTATATGTTCATATTGGATTGCGCCTTTGTATTATAAAAGCTCAGATGACATTTCGTTTTTTACACGAGATTTCTTTTTTATGTGATGCCAAAGATGTTTGAAAATGCTCTTAAAATATCTTCCTTTGGGGAAGTTTATTTGAGAAAATATAATAAAAGAAAAAAGTAAAGGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

Insert Property: Insert 1

Type Value Extra Information
CDS Start 197
CDS Stop 1030

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

AGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGAGCTTGCAATTCGCGCGTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTAGTACGAGGCCCTTTCACTCATTAGATGCATGTCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGGACTCTAGCCTAGGCCGCGGGACGGATAACAATTTCACACAGGAAACAGCTATGACCATTAGGCCTATTTAGGTGACACTATAGAACAAGTTTGTACAAAAAAGCAGGCTGGTACCGGTCCGGAATTCCCGGGAT CCCCCGTCTACCTCTCTCCTTGGTCCTGGAACAGCGCTACTGATCACCAAGTAGCCACAAAATATAATAAACCCTCAGCACTTGCTCAGTAGTTTTGTGAAAGTCTCAAGTAAAAGAGACACAAACAAAAAATTCTTTTTCGTGAAGAACTCCAAAAATAAAATTCTCTAGAGATAAAAAAAAAAAAAAAAGGAAAATGCCAGCTGATATAATGGAGAAAAATTCCTCGTCCCCGGTAGCAGCCAGTGTCAACACGACACCGGATAAACCAAAGACAGCATCTGAGCACAGAAAGTCATCAAAGCCTATTATGGAGAAAAGACGAAGAGCAAGAATAAATGAAAGTCTGAGCCAGCTGAAAACACTGATTTTGGATGCTCTGAAGAAAGATAGCTCGCGGCATTCCAAGCTGGAGAAGGCGGACATTCTGGAAATGACAGTGAAGCACCTCCGGAACCTGCAGCGGGCGCAGATGACGGCTGCGCTGAGCACAGACCCAAGTGTGCTGGGGAAGTACCGAGCCGGCTTCAGCGAGTGCATGAACGAGGTGACCCGCTTCCTGTCCACGTGCGAGGGCGTTAATACCGAGGTGCGCACTCGGCTGCTCGGCCACCTGGCCAACTGCATGACCCAGATCAATGCCATGACCTACCCCGGGCAGCCGCACCCCGCCTTGCAGGCGCCGCCACCGCCCCCACCGGGACCCGGCGGCCCCCAGCACGCGCCGTTCGCGCCGCCGCCGCCACTCGTGCCCATCCCCGGGGGCGCGGCGCCCCCTCCCGGCGGCGCCCCCTGCAAGCTGGGCAGCCAGGCTGGAGAGGCGGCTAAGGTGTTTGGAGGCTTCCAGGTGGTACCGGCTCCCGATGGCCAGTTTGCTTTCCTCATTCCCAACGGGGCCTTCGCGCACAGCGGCCCTGTCATCCCCGTCTACACCAGCAACAGCGGCACCTCCGTGGGCCCCAACGCAGTGTCACCTTCCAGCGGCCCCTCGCTTACGGCGGACTCCATGTGGAGGCCGTGGCGGAACTGAGGGGGCTCAGGCCACCCCTCCTCCTAAACTCCCCAACCCACCTCTCTTCCCTCCGGACTCTAAACAGGAACTTGAATACTGGGAGAGAAGAGGACTTTTTTGATTAAGTGGTTACTTTGTGTTTTTTTAATTTCTAAGAAGTTACTTTTTGTAGAGAGAGCTGTATTAAGTGACTGACCATGCACTATATTTGTATATATTTTATATGTTCATATTGGATTGCGCCTTTGTATTATAAAAGCTCAGATGACATTTCGTTTTTTACACGAGATTTCTTTTTTATGTGATGCCAAAGATGTTTGAAAATGCTCTTAAAATATCTTCCTTTGGGGAAGTTTATTTGAGAAAATATAATAAAAGAAAAAAGTAAAGGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAANNNNNACCCAGCTTTCTTGTACAAAGTGGTCCCTATAGTGAGTCGTATTATAAGCTAGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACTGCTAGCTTGGGATCTTTGTGAAGGAACCTTACTTCTGTGGTGTGACATAATTGGACAAACTACCTACAGAGATTTAAAGCTCTAAGGTAAATATAAAATTTTTAAGTGTATAATGTGTTAAACTAGCTGCATATGCTTGCTGCTTGAGAGTTTTGCTTACTGAGTATGATTTATGAAAATATTATACACAGGAGCTAGTGATTCTAATTGTTTGTGTATTTTAGATTCACAGTCCCAAGGCTCATTTCAGGCCCCTCAGTCCTCACAGTCTGTTCATGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCGATCCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGCCAGGTCTTGGACTGGTGAGAACGGCTTGCTCGGCAGCTTCGATGTGTGCTGGAGGGAGAATAAAGGTCTAAGATGTGCGATAGAGGGAAGTCGCATTGAATTATGTGCTGTGTAGGGATCGCTGGTATCAAATATGTGTGCCCACCCCTGGCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGCCATAACTTCGTATAATGTATGCTATACGAAGTTATGGCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAA

Sequencing Information:

Phred Score: 896
Date: 2019-03-13

Last Passing Sequencing Read:

NNTTTTACATGAGCTTACANACTCGTTAGTGACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGGACTCTAGCCTAGGCCGCGGGACGGATAACAATTTCACACAGGAAACAGCTATGACCATTAGGCCTATTTAGGTGACACTATAGAACAAGTTTGTACAAAAAAGCAGGCTGGTACCGGTCCGGAATTCCCGGGATCCCCCGTCTACCTCTCTCCTTGGTCCTGGAACAGCGCTACTGATCACCAAGTAGCCACAAAATATAATAAACCCTCAGCACTTGCTCAGTAGTTTTGTGAAAGTCTCAAGTAAAAGAGACACAAACAAAAAATTCTTTTTCGTGAAGAACTCCAAAAATAAAATTCTCTAGAGATAAAAAAAAAAAAAAAAGGAAAATGCCAGCTGATATAATGGAGAAAAATTCCTCGTCCCCGGTAGCAGCCAGTGTCAACACGACACCGGATAAACCAAAGACAGCATCTGAGCACAGAAAGTCATCAAAGCCTATTATGGAGAAAAGACGAAGAGCAAGAATAAATGAAAGTCTGAGCCAGCTGAAAACACTGATTTTGGATGCTCTGAAGAAAGATAGCTCGCGGCATTCCAAGCTGGAGAAGGCGGACATTCTGGAAATGACAGTGAAGCACCTCCGGAACCTGCAGCGGGCGCAGATGACGGCTGCGCTGAGCACAGACCCAAGTGTGCTGGGGAAGTACCGAGCCGGCTTCAGCGAGTGCATGAACGAGGTGACCCGCTTCCTGTCCACGTGCGAGGGCGTTAATACCGAGGTGCGCACTCGGCTGCTCGGCCACCTGGCCAACTGCATGACCCAGATCAATGCCATGACCTACCCCGGGCAGCCGCACCCCGCCTTGCAGGCGCCGCCACCGCCCCCCACGGGGACCGGCGGGCCCCAGCACGCGCCGTTCGCGCCGCCGCCGCCACTCGTGCCCATCCCCGGGGGCGCGGCGCCCCCCTCCCGCNGCGCCCCCCTGCAGCTGGGCAGCCCAGCTGGAGAGCGGCTAANGTGTTGGAAGCTTCCAGTGGTACCGCTCCCGATGGNCAGTTGCTTNCTCATCCNNACGGGNCTTCNGCAAAGGGCCCTGTATCCCGTCTACACANAACANGGGACTCGTGGGCCCAAGCATGTCACTTCAGCGGCCCTCTTANGGGGAATCAGTGAAGCGTGGCGGACTGAGGGNCTAGCACCTCCTTTAATCCCAACAATTTTTCCCTCGATCTAAGGATTGAACGGGGAAAAAAGCTTTTTAAAGGGCTTTGGTTTTATTCTAAATCTTTGGAAAAGG

Vector Information:

Vector Name:pCMV-SPORT6.ccdb
Type:bacterial plasmid
Description:Gateway vector with CMV promoter and ampicillin resistance in bacteria
Properties:mammalian expression
Comments:also known as pCMV-SPORT6.1.ccdb
Map:pCMV-Sport6ccdB.gif
Sequence:pCMV_Sport_6_ccdb.txt
Size (bp):4807
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
MGC Consortium