Clone: HsCD00331514

Clone ID:HsCD00331514
Is Verified:Y
Status:AVAILABLE
Source:MGC
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

GenBank Accession BC012342
Original Clone ID MGC:19923
IMAGE ID 4552767
GI 15214433

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 3540 Homo sapiens CLOSED 1540 CYLD cylindromatosis (turban tumor syndrome)
Insert1
Size (bp)3540
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 1540
Gene SymbolCYLD
Gene Namecylindromatosis (turban tumor syndrome)
Keyword

Insert Sequence:

GTGTGGGGAGCCGGGGCCGGCCCGGGACGCGGGCTGGGGAGCCGGGGCGAGGGGCGACGCCCCGCCGCCCGAGTTTCCCCCTTTCTAGGGTGAGGATGGTTCTACACAGCCACCCGGAGTTCCTTAGTTGAAAGGTGCGCCCTGCTGTGACAGCATGGACACCACGTTGCTGAAAACATGCTTTGGGACTGCCACTGAATTTATCTTTTGCGGTTTTATGACAAAGTTATTAGTAGTTTCCCTTTTTTGAATTAGTATTTTGAAGTTAATATCACAATGAGTTCAGGCTTATGGAGCCAAGAAAAAGTCACTTCACCCTACTGGGAAGAGCGGATTTTTTACTTGCTTCTTCAAGAATGCAGCGTTACAGACAAACAAACACAAAAGCTCCTTAAAGTACCGAAGGGAAGTATAGGACAGTATATTCAAGATCGTTCTGTGGGGCATTCAAGGATTCCTTCTGCAAAAGGCAAGAAAAATCAGATTGGATTAAAAATTCTAGAGCAACCTCATGCAGTTCTCTTTGTTGATGAAAAGGATGTTGTAGAGATAAATGAAAAGTTCACAGAGTTACTTTTGGCAATTACCAATTGTGAGGAGAGGTTCAGCCTGTTTAAAAACAGAAACAGACTAAGTAAAGGCCTCCAAATAGACGTGGGCTGTCCTGTGAAAGTACAGCTGAGATCTGGGGAAGAAAAATTTCCTGGAGTTGTACGCTTCAGAGGACCCCTGTTAGCAGAGAGGACAGTCTCCGGAATATTCTTTGGAGTTGAATTGCTGGAAGAAGGTCGTGGTCAAGGTTTCACTGACGGGGTGTACCAAGGGAAACAGCTTTTTCAGTGTGATGAAGATTGTGGCGTGTTTGTTGCATTGGACAAGCTAGAACTCATAGAAGATGATGACACTGCATTGGAAAGTGATTACGCAGGTCCTGGGGACACAATGCAGGTCGAACTTCCTCCTTTGGAAATAAACTCCAGAGTTTCTTTGAAGGTTGGAGAAACAATAGAATCTGGAACAGTTATATTCTGTGATGTTTTGCCAGGAAAAGAAAGCTTAGGATATTTTGTTGGTGTGGACATGGATAACCCTATTGGCAACTGGGATGGAAGATTTGATGGAGTGCAGCTTTGTAGTTTTGCGTGTGTTGAAAGTACAATTCTATTGCACATCAATGATATCATCCCAGAGAGTGTGACGCAGGAAAGGAGGCCTCCCAAACTTGCCTTTATGTCAAGAGGTGTTGGGGACAAAGGTTCATCCAGTCATAATAAACCAAAGGCTACAGGATCTACCTCAGACCCTGGAAATAGAAACAGATCTGAATTATTTTATACCTTAAATGGGTCTTCTGTTGACTCACAACCACAATCCAAATCAAAAAATACATGGTACATTGATGAAGTTGCAGAAGACCCTGCAAAATCTCTTACAGAGATATCTACAGACTTTGACCGTTCTTCACCACCACTCCAGCCTCCTCCTGTGAACTCACTGACCACCGAGAACAGATTCCACTCTTTACCATTCAGTCTCACCAAGATGCCCAATACCAATGGAAGTATTGGCCACAGTCCACTTTCTCTGTCAGCCCAGTCTGTAATGGAAGAGCTAAACACTGCACCCGTCCAAGAGAGTCCACCCTTGGCCATGCCTCCTGGGAACTCACATGGTCTAGAAGTGGGCTCATTGGCTGAAGTTAAGGAGAACCCTCCTTTCTATGGGGTAATCCGTTGGATCGGTCAGCCACCAGGACTGAATGAAGTGCTCGCTGGACTGGAACTGGAAGATGAGTGTGCAGGCTGTACGGATGGAACCTTCAGAGGCACTCGGTATTTCACCTGTGCCCTGAAGAAGGCGCTGTTTGTGAAACTGAAGAGCTGCAGGCCTGACTCTAGGTTTGCATCATTGCAGCCGGTTTCCAATCAGATTGAGCGCTGTAACTCTTTAGCATTTGGAGGCTACTTAAGTGAAGTAGTAGAAGAAAATACTCCACCAAAAATGGAAAAAGAAGGCTTGGAGATAATGATTGGGAAGAAGAAAGGCATCCAGGGTCATTACAATTCTTGTTACTTAGACTCAACCTTATTCTGCTTATTTGCTTTTAGTTCTGTTCTGGACACTGTGTTACTTAGACCCAAAGAAAAGAACGATGTAGAATATTATAGTGAAACCCAAGAGCTACTGAGGACAGAAATTGTTAATCCTCTGAGAATATATGGATATGTGTGTGCCACAAAAATTATGAAACTGAGGAAAATACTTGAAAAGGTGGAGGCTGCATCAGGATTTACCTCTGAAGAAAAAGATCCTGAGGAATTCTTGAATATTCTGTTTCATCATATTTTAAGGGTAGAACCTTTGCTAAAAATAAGATCAGCAGGTCAAAAGGTACAAGATTGTTACTTCTATCAAATTTTTATGGAAAAAAATGAGAAAGTTGGCGTTCCCACAATTCAGCAGTTGTTAGAATGGTCTTTTATCAACAGTAACCTGAAATTTGCAGAGGCACCATCATGTCTGATTATTCAGATGCCTCGATTTGGAAAAGACTTTAAACTATTTAAAAAAATTTTTCCTTCTCTGGAATTAAATATAACAGATTTACTTGAAGACACTCCCAGACAGTGCCGGATATGTGGAGGGCTTGCAATGTATGAGTGTAGAGAATGCTACGACGATCCGGACATCTCAGCTGGAAAAATCAAGCAGTTTTGTAAAACCTGCAACACTCAAGTCCACCTTCATCCGAAGAGGCTGAATCATAAATATAACCCAGTGTCACTTCCCAAAGACTTACCCGACTGGGACTGGAGACACGGCTGCATCCCTTGCCAGAATATGGAGTTATTTGCTGTTCTCTGCATAGAAACAAGCCACTATGTTGCTTTTGTGAAGTATGGGAAGGACGATTCTGCCTGGCTCTTCTTTGACAGCATGGCCGATCGGGATGGTGGTCAGAATGGCTTCAACATTCCTCAAGTCACCCCATGCCCAGAAGTAGGAGAGTACTTGAAGATGTCTCTGGAAGACCTGCATTCCTTGGACTCCAGGAGAATCCAAGGCTGTGCACGAAGACTGCTTTGTGATGCATATATGTGCATGTACCAGAGTCCAACAATGAGTTTGTACAAATAACTGGGGTCATCGGGAAAGGCAAAGAAACTGAAGGCAGAGTCCTAACGTTGCATCTTATTCGAGCTGGCAGTTCTGTTCACGTCCATTGCCGGCAATGGATGTCTTTGTGGTGATGATCCTTCAGAAAAGGATGCCTCTGTTTAAAAACAAATTGCTTTTGTGTCCCTGAAGTATTTAATAAGAAGCATTTTGCACTCTAGAAAGTATGTTTGTGTTGGTTTTTTAAGAAGTCTAAATGAAGTTATTAATACCTGAAGCTTTAAGTTAAGTGCATTGATCATATGATATTTTTGGAAGCATACAATTTTAATTGTGGAAGTTTAAAGCCTCTTTTAGTCCCTTGAGAATGTAAATAAATGTGTCTTCTTTATGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

Insert Property: Insert 1

Type Value Extra Information
CDS Start 277
CDS Stop 3138

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGATCACAACAAAAAGCCCGCTCATTAGGCGGGCTAAATTCTCATGTTTGACAGCTTATCATCGATAAGCTAGCGGCCGCTAGCTTTAATGAGTTATCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAGTTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTTTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTAATTGGTACGTCGACGTTAGAACGCGGCTACAATTAATACATAACCTTATGTATCATACACATACGATTTAGGTGACACTATAGAACTCGAAGGATCCACAAGTTTGTACAAAAAAGCAGGCTTGTAAAACGACGGCCAGTAACTATAACGGTCCTAAGGTAGCGAGGCCTGGGTGGCGAATTCGGCACGAGGGTGTGGGGAGCCGGGGCCGGCCCGGGACGCGGGCTGGGGAGCCGGGGCGAGGGGCGACGCCCCGCCGCCCGAGTTTCCCCCTTTCTAGGGTGAGGATGGTTCTACACAGCCACCCGGAGTTCCTTAGTTGAAAGGTGCGCCCTGCTGTGACAGCATGGACACCACGTTGCTGAAAACATGCTTTGGGACTGCCACTGAATTTATCTTTTGCGGTTTTATGACAAAGTTATTAGTAGTTTCCCTTTTTTGAATTAGTATTTTGAAGTTAATATCACAATGAGTTCAGGCTTATGGAGCCAAGAAAAAGTCACTTCACCCTACTGGGAAGAGCGGATTTTTTACTTGCTTCTTCAAGAATGCAGCGTTACAGACAAACAAACACAAAAGCTCCTTAAAGTACCGAAGGGAAGTATAGGACAGTATATTCAAGATCGTTCTGTGGGGCATTCAAGGATTCCTTCTGCAAAAGGCAAGAAAAATCAGATTGGATTAAAAATTCTAGAGCAACCTCATGCAGTTCTCTTTGTTGATGAAAAGGATGTTGTAGAGATAAATGAAAAGTTCACAGAGTTACTTTTGGCAATTACCAATTGTGAGGAGAGGTTCAGCCTGTTTAAAAACAGAAACAGACTAAGTAAAGGCCTCCAAATAGACGTGGGCTGTCCTGTGAAAGTACAGCTGAGATCTGGGGAAGAAAAATTTCCTGGAGTTGTACGCTTCAGAGGACCCCTGTTAGCAGAGAGGACAGTCTCCGGAATATTCTTTGGAGTTGAATTGCTGGAAGAAGGTCGTGGTCAAGGTTTCACTGACGGGGTGTACCAAGGGAAACAGCTTTTTCAGTGTGATGAAGATTGTGGCGTGTTTGTTGCATTGGACAAGCTAGAACTCATAGAAGATGATGACACTGCATTGGAAAGTGATTACGCAGGTCCTGGGGACACAATGCAGGTCGAACTTCCTCCTTTGGAAATAAACTCCAGAGTTTCTTTGAAGGTTGGAGAAACAATAGAATCTGGAACAGTTATATTCTGTGATGTTTTGCCAGGAAAAGAAAGCTTAGGATATTTTGTTGGTGTGGACATGGATAACCCTATTGGCAACTGGGATGGAAGATTTGATGGAGTGCAGCTTTGTAGTTTTGCGTGTGTTGAAAGTACAATTCTATTGCACATCAATGATATCATCCCAGAGAGTGTGACGCAGGAAAGGAGGCCTCCCAAACTTGCCTTTATGTCAAGAGGTGTTGGGGACAAAGGTTCATCCAGTCATAATAAACCAAAGGCTACAGGATCTACCTCAGACCCTGGAAATAGAAACAGATCTGAATTATTTTATACCTTAAATGGGTCTTCTGTTGACTCACAACCACAATCCAAATCAAAAAATACATGGTACATTGATGAAGTTGCAGAAGACCCTGCAAAATCTCTTACAGAGATATCTACAGACTTTGACCGTTCTTCACCACCACTCCAGCCTCCTCCTGTGAACTCACTGACCACCGAGAACAGATTCCACTCTTTACCATTCAGTCTCACCAAGATGCCCAATACCAATGGAAGTATTGGCCACAGTCCACTTTCTCTGTCAGCCCAGTCTGTAATGGAAGAGCTAAACACTGCACCCGTCCAAGAGAGTCCACCCTTGGCCATGCCTCCTGGGAACTCACATGGTCTAGAAGTGGGCTCATTGGCTGAAGTTAAGGAGAACCCTCCTTTCTATGGGGTAATCCGTTGGATCGGTCAGCCACCAGGACTGAATGAAGTGCTCGCTGGACTGGAACTGGAAGATGAGTGTGCAGGCTGTACGGATGGAACCTTCAGAGGCACTCGGTATTTCACCTGTGCCCTGAAGAAGGCGCTGTTTGTGAAACTGAAGAGCTGCAGGCCTGACTCTAGGTTTGCATCATTGCAGCCGGTTTCCAATCAGATTGAGCGCTGTAACTCTTTAGCATTTGGAGGCTACTTAAGTGAAGTAGTAGAAGAAAATACTCCACCAAAAATGGAAAAAGAAGGCTTGGAGATAATGATTGGGAAGAAGAAAGGCATCCAGGGTCATTACAATTCTTGTTACTTAGACTCAACCTTATTCTGCTTATTTGCTTTTAGTTCTGTTCTGGACACTGTGTTACTTAGACCCAAAGAAAAGAACGATGTAGAATATTATAGTGAAACCCAAGAGCTACTGAGGACAGAAATTGTTAATCCTCTGAGAATATATGGATATGTGTGTGCCACAAAAATTATGAAACTGAGGAAAATACTTGAAAAGGTGGAGGCTGCATCAGGATTTACCTCTGAAGAAAAAGATCCTGAGGAATTCTTGAATATTCTGTTTCATCATATTTTAAGGGTAGAACCTTTGCTAAAAATAAGATCAGCAGGTCAAAAGGTACAAGATTGTTACTTCTATCAAATTTTTATGGAAAAAAATGAGAAAGTTGGCGTTCCCACAATTCAGCAGTTGTTAGAATGGTCTTTTATCAACAGTAACCTGAAATTTGCAGAGGCACCATCATGTCTGATTATTCAGATGCCTCGATTTGGAAAAGACTTTAAACTATTTAAAAAAATTTTTCCTTCTCTGGAATTAAATATAACAGATTTACTTGAAGACACTCCCAGACAGTGCCGGATATGTGGAGGGCTTGCAATGTATGAGTGTAGAGAATGCTACGACGATCCGGACATCTCAGCTGGAAAAATCAAGCAGTTTTGTAAAACCTGCAACACTCAAGTCCACCTTCATCCGAAGAGGCTGAATCATAAATATAACCCAGTGTCACTTCCCAAAGACTTACCCGACTGGGACTGGAGACACGGCTGCATCCCTTGCCAGAATATGGAGTTATTTGCTGTTCTCTGCATAGAAACAAGCCACTATGTTGCTTTTGTGAAGTATGGGAAGGACGATTCTGCCTGGCTCTTCTTTGACAGCATGGCCGATCGGGATGGTGGTCAGAATGGCTTCAACATTCCTCAAGTCACCCCATGCCCAGAAGTAGGAGAGTACTTGAAGATGTCTCTGGAAGACCTGCATTCCTTGGACTCCAGGAGAATCCAAGGCTGTGCACGAAGACTGCTTTGTGATGCATATATGTGCATGTACCAGAGTCCAACAATGAGTTTGTACAAATAACTGGGGTCATCGGGAAAGGCAAAGAAACTGAAGGCAGAGTCCTAACGTTGCATCTTATTCGAGCTGGCAGTTCTGTTCACGTCCATTGCCGGCAATGGATGTCTTTGTGGTGATGATCCTTCAGAAAAGGATGCCTCTGTTTAAAAACAAATTGCTTTTGTGTCCCTGAAGTATTTAATAAGAAGCATTTTGCACTCTAGAAAGTATGTTTGTGTTGGTTTTTTAAGAAGTCTAAATGAAGTTATTAATACCTGAAGCTTTAAGTTAAGTGCATTGATCATATGATATTTTTGGAAGCATACAATTTTAATTGTGGAAGTTTAAAGCCTCTTTTAGTCCCTTGAGAATGTAAATAAATGTGTCTTCTTTATGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAACTCGAGGCATCTATGTCGGGTGCGGAGAAAGAGGTAATGAAATGGCACATGGTCATAGCTGTTTCCTGACCCAGCTTTCTTGTACAAAGTGGTAGATCTGCCGGTCTCCCTATAGTGAGTCGTATTAATTTCGATAAGCCAGGTTAACCTGCATTAATGAATCGGCTGCAGTACCCGGGAATTTAACCCGCCTAATGAGCGGGCTTTTTTTTGTGATCCAAAGGAT

Sequencing Information:

Phred Score: 910
Date: 2019-01-10

Last Passing Sequencing Read:

NNNNAAAATCAGACGAGGCTGGNGGCGATTCGGCACGAGGGTGTGGGGAGCCGGGGCCGGCCCGGGACGCGGGCTGGGGAGCCGGGGCGAGGGGCGACGCCCCGCCGCCCGAGTTTCCCCCTTTCTAGGGTGAGGATGGTTCTACACAGCCACCCGGAGTTCCTTAGTTGAAAGGTGCGCCCTGCTGTGACAGCATGGACACCACGTTGCTGAAAACATGCTTTGGGACTGCCACTGAATTTATCTTTTGCGGTTTTATGACAAAGTTATTAGTAGTTTCCCTTTTTTGAATTAGTATTTTGAAGTTAATATCACAATGAGTTCAGGCTTATGGAGCCAAGAAAAAGTCACTTCACCCTACTGGGAAGAGCGGATTTTTTACTTGCTTCTTCAAGAATGCAGCGTTACAGACAAACAAACACAAAAGCTCCTTAAAGTACCGAAGGGAAGTATAGGACAGTATATTCAAGATCGTTCTGTGGGGCATTCAAGGATTCCTTCTGCAAAAGGCAAGAAAAATCAGATTGGATTAAAAATTCTAGAGCAACCTCATGCAGTTCTCTTTGTTGATGAAAAGGATGTTGTAGAGATAAATGAAAAGTTCACAGAGTTACTTTTGGCAATTACCAATTGTGAGGAGAGGTTCAGCCTGTTTAAAAACAGAAACAGACTAAGTAAAGGCCTCCAAATAGACGTGGGCTGTCCTGTGAAAGTACAGCTGAGATCTGGGGAAGAAAAATTTCCTGGAGTTGTACGCTTCAGAGGACCCCTGTTAGCAGAGAGGACAGTCTCCGGAATATTCTTTGGAGTTGAATTGCTGGAAGAAGGTCGTGGTCAAGGTTTCACTGACGGGGTGTACCAAGGGAAACAGCTTTTTCAGTGTGATGAAGATTGTGGCGTGTTTGTTGCATTGGACAAGCTAGAACTCATAGAAGATGATGACACTGCATTGGAAAGTGATTACGCANGTCCTGGGGACACAATGCANGTCGAACTTCCTCCTTTGGAAATAACTCCAGAGTTTCNNTTGAGGTGGAGAAANCATAGATCTGGAACAGTTATATTCTGTGATGTTTTGCAGGAAAAGAAGCTTANGATATTTTGTGNGTGNACATGGATACCNTATTGNNCACTGGATGAAGAATTGATGNAATGCAACTTTGTANTTTGCTGTGTTGAAAGTCAATTCTATGCCATCAATGATTCTTCCAAAAAATGGGACCCAAGAAAGAAGCCTCCAAACTTGCCTTAAGTCAAAGGGTTTGGGAACAAGTTCTTCCGTCTAAAAACCAAGGCATCGGATTTCCTCAACCCGGAAATAAACAATCGAAATATTTTACCCTAAGGGCC

Vector Information:

Vector Name:pOTB7
Type:bacterial plasmid
Description:Gateway® or compatible clone with M13 forward and M13 reverse primers. Chloramphenicol resistance in bacteria. More information available at http://genecollections.nci.nih.gov/MGC/Vectors/prot_potb7
Properties:Gateway
Comments:A set of thirty-six MGC libraries was made in this vector by Dr. Gerry Rubin, University of California, Berkeley CA. Briefly, the method was as follows: Poly A+RNA was reverse trancribed using an anchored oligo-dT primer with an Xho I site. Double stranded cDNA was prepared using a cDNA synthesis kit. The double stranded cDNA was ligated to Eco RI adaptors, digested with Xho I, size selected over a column, and ligated into the vector. The pOTB7 vector was constructed by Dr. Michael Brownstein, National Institute of Mental Health, NIH, Bethesda, MD.
Map:potb7.gif
Sequence:pOTB7.txt
Size (bp):1815
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant N

Antibiotic Selections:

Host Type Marker
bacterial chloramphenicol

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 30 ug/mL chloramphenicol Growth at 37 degrees C in LB supplemented with chloramphenicol (30 ug/mL)

Authors:

Author Name Author Type
MGC Consortium