Clone: HsCD00324730

Clone ID:HsCD00324730
Is Verified:Y
Status:AVAILABLE
Source:MGC
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

GI 33869880
IMAGE ID 3507836
GenBank Accession BC005149
Original Clone ID MGC:3287

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 2078 Homo sapiens CLOSED 57192 MCOLN1 mucolipin 1
Insert1
Size (bp)2078
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 57192
Gene SymbolMCOLN1
Gene Namemucolipin 1
Keyword

Insert Sequence:

ATCAGCTGATGCCGGAGGGTTTGAAGCCGCGCCGCGAGGGAGCGAGGTCGCAGTGACAGCGGCGGGCGATCGGACCCAGGCTGCCCCGCCGTACCCGCCTGCGTCCCGCGCTCCCGCCCCAGCATGACAGCCCCGGCGGGTCCGCGCGGCTCAGAGACCGAGCGGCTTCTGACCCCCAACCCCGGGTATGGGACCCAGGCGGGGCCTTCACCGGCCCCTCCGACACCCCCAGAAGAGGAAGACCTTCGCCGTCGTCTCAAATACTTTTTCATGAGTCCCTGCGACAAGTTTCGAGCCAAGGGCCGCAAGCCCTGCAAGCTGATGCTGCAAGTGGTCAAGATCCTGGTGGTCACGGTGCAGCTCATCCTGTTTGGGCTCAGTAATCAGCTGGCTGTGACATTCCGGGAAGAGAACACCATCGCCTTCCGACACCTCTTCCTGCTGGGCTACTCGGACGGAGCGGATGACACCTTCGCAGCCTACACGCGGGAGCAGCTGTACCAGGCCATCTTCCATGCTGTGGACCAGTACCTGGCGTTGCCTGACGTGTCACTGGGCCGGTATGCGTATGTCCGTGGTGGGGGTGACCCTTGGACCAATGGCTCAGGGCTTGCTCTCTGCCAGCGGTACTACCACCGAGGCCACGTGGACCCGGCCAACGACACATTTGACATTGATCCGATGGTGGTTACTGACTGCATCCAGGTGGATCCCCCCGAGCGGCCCCCTCCGCCCCCCAGCGACGATCTCACCCTCTTGGAAAGCAGCTCCAGTTACAAGAACCTCACGCTCAAATTCCACAAGCTGGTCAATGTCACCATCCACTTCCGGCTGAAGACCATTAACCTCCAGAGCCTCATCAATAATGAGATCCCGGACTGCTATACCTTCAGCGTCCTGATCACGTTTGACAACAAAGCACACAGTGGGCGGATCCCCATCAGCCTGGAGACCCAGGCCCACATCCAGGAGTGTAAGCACCCCAGTGTCTTCCAGCACGGAGACAACAGCTTCCGGCTCCTGTTTGACGTGGTGGTCATCCTCACCTGCTCCCTGTCCTTCCTCCTCTGCGCCCGCTCACTCCTTCGAGGCTTCCTGCTGCAGAACGAGTTTGTGGGGTTCATGTGGCGGCAGCGGGGACGGGTCATCAGCCTGTGGGAGCGGCTGGAATTTGTCAATGGCTGGTACATCCTGCTCGTCACCAGCGATGTGCTCACCATCTCGGGCACCATCATGAAGATCGGCATCGAGGCCAAGAACTTGGCGAGCTACGACGTCTGCAGCATCCTCCTGGGCACCTCGACGCTGCTGGTGTGGGTGGGCGTGATCCGCTACCTGACCTTCTTCCACAACTACAATATCCTCATCGCCACACTGCGGGTGGCCCTGCCCAGCGTCATGCGCTTCTGCTGCTGCGTGGCTGTCATCTACCTGGGCTACTGCTTCTGTGGCTGGATCGTGCTGGGGCCCTATCATGTGAAGTTCCGCTCACTCTCCATGGTGTCTGAGTGCCTGTTCTCGCTCATCAATGGGGACGACATGTTTGTGACGTTCGCCGCCATGCAGGCGCAGCAGGGCCGCAGCAGCCTGGTGTGGCTCTTCTCCCAGCTCTACCTTTACTCCTTCATCAGCCTCTTCATCTACATGGTGCTCAGCCTCTTCATCGCGCTCATCACCGGCGCCTACGACACCATCAAGCATCCCGGCGGCGCAGGCGCAGAGGAGAGCGAGCTGCAGGCCTACATCGCACAGTGCCAGGACAGCCCCACCTCCGGCAAGTTCCGCCGCGGGAGCGGCTCGGCCTGCAGCCTTCTCTGCTGCTGCGGAAGGGACCCCTCGGAGGAGCATTCGCTGCTGGTGAATTGATTCGACCTGACTGCCGTTGGACCGTAGGCCCTGGACTGCAGAGACCCCCGCCCCCGACCCCGCTTATTTATTTGTAGGGTTTGCTTTTAAGGATCGGCTCCCTGTCGCGCCCGAGGAGGGCCTGGACCTTTCGTGTCGGACCCTTGGGGGCGGGGAGACTGGGTGGGGAGGGTGTTGAATAAAAGGGAAAATAAAAAAAAAAAAAAAAAAAA

Insert Property: Insert 1

Type Value Extra Information
CDS Start 124
CDS Stop 1866

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGATCACAACAAAAAGCCCGCTCATTAGGCGGGCTAAATTCTCATGTTTGACAGCTTATCATCGATAAGCTAGCGGCCGCTAGCTTTAATGAGTTATCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAGTTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTTTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTAATTGGTACGTCGACGTTAGAACGCGGCTACAATTAATACATAACCTTATGTATCATACACATACGATTTAGGTGACACTATAGAACTCGAAGGATCCACAAGTTTGTACAAAAAAGCAGGCTTGTAAAACGACGGCCAGTAACTATAACGGTCCTAAGGTAGCGAGGCCTGGGTGGCGAATTCGGCACGAGGATCAGCTGATGCCGGAGGGTTTGAAGCCGCGCCGCGAGGGAGCGAGGTCGCAGTGACAGCGGCGGGCGATCGGACCCAGGCTGCCCCGCCGTACCCGCCTGCGTCCCGCGCTCCCGCCCCAGCATGACAGCCCCGGCGGGTCCGCGCGGCTCAGAGACCGAGCGGCTTCTGACCCCCAACCCCGGGTATGGGACCCAGGCGGGGCCTTCACCGGCCCCTCCGACACCCCCAGAAGAGGAAGACCTTCGCCGTCGTCTCAAATACTTTTTCATGAGTCCCTGCGACAAGTTTCGAGCCAAGGGCCGCAAGCCCTGCAAGCTGATGCTGCAAGTGGTCAAGATCCTGGTGGTCACGGTGCAGCTCATCCTGTTTGGGCTCAGTAATCAGCTGGCTGTGACATTCCGGGAAGAGAACACCATCGCCTTCCGACACCTCTTCCTGCTGGGCTACTCGGACGGAGCGGATGACACCTTCGCAGCCTACACGCGGGAGCAGCTGTACCAGGCCATCTTCCATGCTGTGGACCAGTACCTGGCGTTGCCTGACGTGTCACTGGGCCGGTATGCGTATGTCCGTGGTGGGGGTGACCCTTGGACCAATGGCTCAGGGCTTGCTCTCTGCCAGCGGTACTACCACCGAGGCCACGTGGACCCGGCCAACGACACATTTGACATTGATCCGATGGTGGTTACTGACTGCATCCAGGTGGATCCCCCCGAGCGGCCCCCTCCGCCCCCCAGCGACGATCTCACCCTCTTGGAAAGCAGCTCCAGTTACAAGAACCTCACGCTCAAATTCCACAAGCTGGTCAATGTCACCATCCACTTCCGGCTGAAGACCATTAACCTCCAGAGCCTCATCAATAATGAGATCCCGGACTGCTATACCTTCAGCGTCCTGATCACGTTTGACAACAAAGCACACAGTGGGCGGATCCCCATCAGCCTGGAGACCCAGGCCCACATCCAGGAGTGTAAGCACCCCAGTGTCTTCCAGCACGGAGACAACAGCTTCCGGCTCCTGTTTGACGTGGTGGTCATCCTCACCTGCTCCCTGTCCTTCCTCCTCTGCGCCCGCTCACTCCTTCGAGGCTTCCTGCTGCAGAACGAGTTTGTGGGGTTCATGTGGCGGCAGCGGGGACGGGTCATCAGCCTGTGGGAGCGGCTGGAATTTGTCAATGGCTGGTACATCCTGCTCGTCACCAGCGATGTGCTCACCATCTCGGGCACCATCATGAAGATCGGCATCGAGGCCAAGAACTTGGCGAGCTACGACGTCTGCAGCATCCTCCTGGGCACCTCGACGCTGCTGGTGTGGGTGGGCGTGATCCGCTACCTGACCTTCTTCCACAACTACAATATCCTCATCGCCACACTGCGGGTGGCCCTGCCCAGCGTCATGCGCTTCTGCTGCTGCGTGGCTGTCATCTACCTGGGCTACTGCTTCTGTGGCTGGATCGTGCTGGGGCCCTATCATGTGAAGTTCCGCTCACTCTCCATGGTGTCTGAGTGCCTGTTCTCGCTCATCAATGGGGACGACATGTTTGTGACGTTCGCCGCCATGCAGGCGCAGCAGGGCCGCAGCAGCCTGGTGTGGCTCTTCTCCCAGCTCTACCTTTACTCCTTCATCAGCCTCTTCATCTACATGGTGCTCAGCCTCTTCATCGCGCTCATCACCGGCGCCTACGACACCATCAAGCATCCCGGCGGCGCAGGCGCAGAGGAGAGCGAGCTGCAGGCCTACATCGCACAGTGCCAGGACAGCCCCACCTCCGGCAAGTTCCGCCGCGGGAGCGGCTCGGCCTGCAGCCTTCTCTGCTGCTGCGGAAGGGACCCCTCGGAGGAGCATTCGCTGCTGGTGAATTGATTCGACCTGACTGCCGTTGGACCGTAGGCCCTGGACTGCAGAGACCCCCGCCCCCGACCCCGCTTATTTATTTGTAGGGTTTGCTTTTAAGGATCGGCTCCCTGTCGCGCCCGAGGAGGGCCTGGACCTTTCGTGTCGGACCCTTGGGGGCGGGGAGACTGGGTGGGGAGGGTGTTGAATAAAAGGGAAAATAAAAAAAAAAAAAAAAAAAACTCGAGGCATCTATGTCGGGTGCGGAGAAAGAGGTAATGAAATGGCACATGGTCATAGCTGTTTCCTGACCCAGCTTTCTTGTACAAAGTGGTAGATCTGCCGGTCTCCCTATAGTGAGTCGTATTAATTTCGATAAGCCAGGTTAACCTGCATTAATGAATCGGCTGCAGTACCCGGGAATTTAACCCGCCTAATGAGCGGGCTTTTTTTTGTGATCCAAAGGAT

Sequencing Information:

Phred Score: 888
Date: 2017-03-28

Last Passing Sequencing Read:

>26958-91_HsCD00043541-M13F_C12 888 1424 32 912 NNNNAATCGTCATAGATTTATTTTGATGAAGTGACCTGTTCGTTGCAACA AATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAG GCTCCACCATGACAGCCCCGGCGGGTCCGCGCGGCTCAGAGACCGAGCGG CTTCTGACCCCCAACCCCGGGTATGGGACCCAGGCGGGGCCTTCACCGGC CCCTCCGACACCCCCAGAAGAGGAAGACCTTCGCCGTCGTCTCAAATACT TTTTCATGAGTCCCTGCGACAAGTTTCGAGCCAAGGGCCGCAAGCCCTGC AAGCTGATGCTGCAAGTGGTCAAGATCCTGGTGGTCACGGTGCAGCTCAT CCTGTTTGGGCTCAGTAATCAGCTGGCTGTGACATTCCGGGAAGAGAACA CCATCGCCTTCCGACACCTCTTCCTGCTGGGCTACTCGGACGGAGCGGAT GACACCTTCGCAGCCTACACGCGGGAGCAGCTGTACCAGGCCATCTTCCA TGCTGTGGACCAGTACCTGGCGTTGCCTGACGTGTCACTGGGCCGGTATG CGTATGTCCGTGGTGGGGGTGACCCTTGGACCAATGGCTCAGGGCTTGCT CTCTGCCAGCGGTACTACCACCGAGGCCACGTGGACCCGGCCAACGACAC ATTTGACATTGATCCGATGGTGGTTACTGACTGCATCCAGGTGGATCCCC CCGAGCGGCCCCCTCCGCCCCCCAGCGACGATCTCACCCTCTTGGAAAGC AGCTCCAGTTACAAGAACCTCACGCTCAAATTCCACAAGCTGGTCAATGT CACCATCCACTTCCGGCTGAAGACCATTAACCTCCAGAGCCTCATCAATA ATGAGATCCCGGACTGCTATACCTTCAGCGTCCTGATCACGTTTGACAAC AAAGCACACAGTGGGCGGATCCCCATCAGCCTGGAGACTCAGGCCCACAT CCAGGAGTGTAAGCACCCCAGTGTCTTCCAGCACGGAGACTACAGCTTCC CGGCTCTTGTTTGACGTGGTGGCCATCCTCACCTGCTCCCTGTCCTTTCT CCTCGTGCGCCCCTCATTCCTTCAAGGCTTCTGCTGAAAAACGAGTTTGT GGGGGTCATGTGGCGGCAGCGGGAACCGGTCATCACCCGTGGAAGCGGCT TGGAATGGTCAATGGCGGNAACATCTGCTCTGTCCAGCGAAGGGTTCCCA TCTCCGCACCCCTCTTAAAATCGGCTCGAGGCAAAAATTGGNGAAGTCCA GATTGGCAATTCTTCTGGGACCTCTAACCTGCTGGGGGGTGGGGCGGATC GCTAACGAACTTTTCACAAATAAATCCTTTTCCCCACTGGGGGGGCCTGC CAGGATTGCCTCTTTGTNGGGGGGGTTTCCTCCGGGCCTCTGTTTGGGGG

Vector Information:

Vector Name:pOTB7
Type:bacterial plasmid
Description:Gateway® or compatible clone with M13 forward and M13 reverse primers. Chloramphenicol resistance in bacteria. More information available at http://genecollections.nci.nih.gov/MGC/Vectors/prot_potb7
Properties:Gateway
Comments:A set of thirty-six MGC libraries was made in this vector by Dr. Gerry Rubin, University of California, Berkeley CA. Briefly, the method was as follows: Poly A+RNA was reverse trancribed using an anchored oligo-dT primer with an Xho I site. Double stranded cDNA was prepared using a cDNA synthesis kit. The double stranded cDNA was ligated to Eco RI adaptors, digested with Xho I, size selected over a column, and ligated into the vector. The pOTB7 vector was constructed by Dr. Michael Brownstein, National Institute of Mental Health, NIH, Bethesda, MD.
Map:potb7.gif
Sequence:pOTB7.txt
Size (bp):1815
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant N

Antibiotic Selections:

Host Type Marker
bacterial chloramphenicol

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 30 ug/mL chloramphenicol Growth at 37 degrees C in LB supplemented with chloramphenicol (30 ug/mL)

Authors:

Author Name Author Type
MGC Consortium