Clone: HsCD00324110

Clone ID:HsCD00324110
Is Verified:Y
Status:AVAILABLE
Source:MGC
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

IMAGE ID 3452929
GI 31565511
GenBank Accession BC053528
Original Clone ID MGC:61614

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 1189 Homo sapiens CLOSED 7341 SUMO1 SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)
Insert1
Size (bp)1189
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 7341
Gene SymbolSUMO1
Gene NameSMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)
Keyword

Insert Sequence:

GTGTTGTGCTGTGGGGAAGGGAGAAGGATTTGTAAACCCCGGAGCGAGGTTCTGCTTACCCGAGGCCGCTGCTGTGCGGAGACCCCCGGGTGAAGCCACCGTCATCATGTCTGACCAGGAGGCAAAACCTTCAACTGAGGACTTGGGGGATAAGAAGGAAGGTGAATATATTAAACTCAAAGTCATTGGACAGGATAGCAGTGAGATTCACTTCAAAGTGAAAATGACAACACATCTCAAGAAACTCAAAGAATCATACTGTCAAAGACAGGGTGTTCCAATGAATTCACTCAGGTTTCTCTTTGAGGGTCAGAGAATTGCTGATAATCATACTCCAAAAGAACTGGGAATGGAGGAAGAAGATGTGATTGAAGTTTATCAGGAACAAACGGGGGGTCATTCAACAGTTTAGATATTCTTTTTATTTTTTTTCTTTTCCCTCAATCCTTTTTTATTTTTAAAAATAGTTCTTTTGTAATGTGGTGTTCAAAACGGAATTGAAAACTGGCACCCCATCTCTTTGAAACATCTGGTAATTTGAATTCTAGTGCTCATTATTCATTATTGTTTGTTTTCATTGTGCTGATTTTTGGTGATCAAGCCTCAGTCCCCTTCATATTACCCTCTCCTTTTTAAAAATTACGTGTGCACAGAGAGGTCACCTTTTTCAGGACATTGCATTTTCAGGCTTGTGGTGATAAATAAGATCGACCAATGCAAGTGTTCATAATGACTTTCCAATTGGCCCTGATGTTCTAGCATGTGATTACTTCACTCCTGGACTGTGACTTTCAGTGGGAGATGGAAGTTTTTCAGAGAACTGAACTGTGGAAAAATGACCTTTCCTTAACTTGAAGCTACTTTTAAAATTTGAGGGTCTGGACCAAAAGAAGAGGAATATCAGGTTGAAGTCAAGATGACAGATAAGGTGAGAGTAATGACTAACTCCAAAGATGGCTTCACTGAAGAAAAGGCATTTTAAGATTTTTTAAAAATCTTGTCAGAAGATCCCAGAAAAGTTCTAATTTTCATTAGCAATTAATAAAGCTATACATGCAGAAATGAATACAACAGAACACTGCTCTTTTTGATTTTATTTGTACTTTTTGGCCTGGGATATGGGTTTTAAATGGACATTGTCTGTACCAGCTTCATTAAAATAAACAATATTTGTAAAAAAAAAAAAAAA

Insert Property: Insert 1

Type Value Extra Information
CDS Start 107
CDS Stop 412

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

AGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGAGCTTGCAATTCGCGCGTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTAGTACGAGGCCCTTTCACTCATTAGATGCATGTCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGGACTCTAGCCTAGGCCGCGGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATTAGGCCTATTTAGGTGACACTATAGAACAAGTTTGTACAAAAAAGCAGGCTGGTACCGGTCCGGAATTCCCGGGATATCGTCGACCCACGCGTCCGGTGTTGTGCTGTGGGGAAGGGAGAAGGATTTGTAAACCCCGGAGCGAGGTTCTGCTTACCCGAGGCCGCTGCTGTGCGGAGACCCCCGGGTGAAGCCACCGTCATCATGTCTGACCAGGAGGCAAAACCTTCAACTGAGGACTTGGGGGATAAGAAGGAAGGTGAATATATTAAACTCAAAGTCATTGGACAGGATAGCAGTGAGATTCACTTCAAAGTGAAAATGACAACACATCTCAAGAAACTCAAAGAATCATACTGTCAAAGACAGGGTGTTCCAATGAATTCACTCAGGTTTCTCTTTGAGGGTCAGAGAATTGCTGATAATCATACTCCAAAAGAACTGGGAATGGAGGAAGAAGATGTGATTGAAGTTTATCAGGAACAAACGGGGGGTCATTCAACAGTTTAGATATTCTTTTTATTTTTTTTCTTTTCCCTCAATCCTTTTTTATTTTTAAAAATAGTTCTTTTGTAATGTGGTGTTCAAAACGGAATTGAAAACTGGCACCCCATCTCTTTGAAACATCTGGTAATTTGAATTCTAGTGCTCATTATTCATTATTGTTTGTTTTCATTGTGCTGATTTTTGGTGATCAAGCCTCAGTCCCCTTCATATTACCCTCTCCTTTTTAAAAATTACGTGTGCACAGAGAGGTCACCTTTTTCAGGACATTGCATTTTCAGGCTTGTGGTGATAAATAAGATCGACCAATGCAAGTGTTCATAATGACTTTCCAATTGGCCCTGATGTTCTAGCATGTGATTACTTCACTCCTGGACTGTGACTTTCAGTGGGAGATGGAAGTTTTTCAGAGAACTGAACTGTGGAAAAATGACCTTTCCTTAACTTGAAGCTACTTTTAAAATTTGAGGGTCTGGACCAAAAGAAGAGGAATATCAGGTTGAAGTCAAGATGACAGATAAGGTGAGAGTAATGACTAACTCCAAAGATGGCTTCACTGAAGAAAAGGCATTTTAAGATTTTTTAAAAATCTTGTCAGAAGATCCCAGAAAAGTTCTAATTTTCATTAGCAATTAATAAAGCTATACATGCAGAAATGAATACAACAGAACACTGCTCTTTTTGATTTTATTTGTACTTTTTGGCCTGGGATATGGGTTTTAAATGGACATTGTCTGTACCAGCTTCATTAAAATAAACAATATTTGTAAAAAAAAAAAAAAAGGGCGGCCGCTCTAGAGTATCCCTCGAGGGGCCCAAGCTTACGCGTACCCAGCTTTCTTGTACAAAGTGGTCCCTATAGTGAGTCGTATTATAAGCTAGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACTGCTAGCTTGGGATCTTTGTGAAGGAACCTTACTTCTGTGGTGTGACATAATTGGACAAACTACCTACAGAGATTTAAAGCTCTAAGGTAAATATAAAATTTTTAAGTGTATAATGTGTTAAACTAGCTGCATATGCTTGCTGCTTGAGAGTTTTGCTTACTGAGTATGATTTATGAAAATATTATACACAGGAGCTAGTGATTCTAATTGTTTGTGTATTTTAGATTCACAGTCCCAAGGCTCATTTCAGGCCCCTCAGTCCTCACAGTCTGTTCATGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCGATCCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGCCAGGTCTTGGACTGGTGAGAACGGCTTGCTCGGCAGCTTCGATGTGTGCTGGAGGGAGAATAAAGGTCTAAGATGTGCGATAGAGGGAAGTCGCATTGAATTATGTGCTGTGTAGGGATCGCTGGTATCAAATATGTGTGCCCACCCCTGGCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGCCATAACTTCGTATAATGTATGCTATACGAAGTTATGGCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAA

Sequencing Information:

Phred Score: 897
Date: 2015-03-18

Last Passing Sequencing Read:

NNNACCGTGACTTAGAGAGCTGTTAGTGACCGTCGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGGACTCTAGCCTAGGCCGCGGGACGGATAACAATTTCACACAGGAAACAGCTATGACCATTAGGCCTATTTAGGTGACACTATAGAACAAGTTTGTACAAAAAAGCAGGCTGGTACCGGTCCGGAATTCCCGGGATATCGTCGACCCACGCGTCCGGTGTTGTGCTGTGGGGAAGGGAGAAGGATTTGTAAACCCCGGAGCGAGGTTCTGCTTACCCGAGGCCGCTGCTGTGCGGAGACCCCCGGGTGAAGCCACCGTCATCATGTCTGACCAGGAGGCAAAACCTTCAACTGAGGACTTGGGGGATAAGAAGGAAGGTGAATATATTAAACTCAAAGTCATTGGACAGGATAGCAGTGAGATTCACTTCAAAGTGAAAATGACAACACATCTCAAGAAACTCAAAGAATCATACTGTCAAAGACAGGGTGTTCCAATGAATTCACTCAGGTTTCTCTTTGAGGGTCAGAGAATTGCTGATAATCATACTCCAAAAGAACTGGGAATGGAGGAAGAAGATGTGATTGAAGTTTATCAGGAACAAACGGGGGGTCATTCAACAGTTTAGATATTCTTTTTATTTTTTTTCTTTTCCCTCAATCCTTTTTTATTTTTAAAAATAGTTCTTTTGTAATGTGGTGTTCAAAACGGAATTGAAAACTGGCACCCCATCTCTTTGAAACATCTGGTAATTTGAATTCTAGTGCTCATTATTCATTATTGTTTGTTTTCATTGTGCTGATTTTTGGTGATCAAGCCTCAGTCCCCTTCATATTACCCTCTCCTTTTTAAAAATTACGTGTGCACAGAGAGGTCACCTTTTTCAGGACATTGCATTTTCAGGCTTGTGGTGATAAATAAGATCGACCAATGCAAGTGTTCATAATGACTTTCCAATTGGCCCTGATGTTCTAGCATGTGATTACTTCACTCCTGACTGTGAACTTCAGTGGGAGATGGAAGTTTCAGAGAACTGAACTGTGAAAAATGACCTTTCTAAACTGAAGCTACTTAAAATTGAGGTCTGACCAAAGAAAGGATTCGGGTGAGTCAAATGACGATAAGGGAGAGTATGCTACTCAAGATGCCTCCTGAAAAAGGCTTTAGATTTTAAAACTTGGCAAAACCCAAAGTTCTATTTCTACATTAAAAGCTCAGGCAGATGAAACAGAAAGGCCCTTTGATATTGACTTTGGCCGAATAGGTAAAGGAATGCGCCCCTTTATAAAAATTGTAAAAAAAAGGGCCTTTAATCCCGGGCCACTACACCCTTTGAAGGCTAAGGGTTAAACGGGGCCTTTACGGGAAACTGTTTTGAAACCTGGGAAGAACCACAAGGAAAATTGGGNCCGCCGTGTTTATATAAAGATTTAATANNCCCCAAAATATCACAGTGAT

Vector Information:

Vector Name:pCMV-SPORT6
Type:bacterial plasmid
Description:Clone with T7, SP6, and CMV promoters and LoxP site. ampicillin resistance in bacteria
Properties:loxP
Comments:An MluI site is introduced upon ligation of a cDNA insert. "pCMV-SPORT6 Library Method Overview: Prior to January 2001, Life Technologies, Invitrogen Corp., Carlsbad, CA, constructed non-normalized (standard) libraries in the pCMV-SPORT6 vector. Briefly, the library method was as follows: First strand cDNA was synthesized from polyA+mRNA using Invitrogen Superscript II RT and an oligo-dT primer containing a Not I site. Second strand cDNA was synthesized. Sal I adapters were ligated onto the double stranded cDNA which was then digested with Not I creating 5'-Sal I/3'- Not I inserts. This cDNA was size-fractionated on a column and ligated into the pCMV-Sport6 vector." http://mgc.nci.nih.gov/Vectors/prot_pcmv-sport6
Map:pcmv-sport6.gif
Sequence:pCMV_Sport_6.txt
Size (bp):4396
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
MGC Consortium