Clone: HsCD00324018

Clone ID:HsCD00324018
Is Verified:Y
Status:AVAILABLE
Source:MGC
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

GI 14714716
IMAGE ID 3450203
Original Clone ID MGC:17293
GenBank Accession BC010501

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 2612 Homo sapiens CLOSED 1500 CTNND1 catenin (cadherin-associated protein), delta 1
Insert1
Size (bp)2612
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 1500
Gene SymbolCTNND1
Gene Namecatenin (cadherin-associated protein), delta 1
Keyword

Insert Sequence:

GGAGCCGGGGCAGATTGTGGAGACCTACACGGAGGAGGATCCTGAGGGAGCCATGTCTGTAGTCTCTGTGGAGACCTCAGATGATGGGACCACTCGGCGCACAGAGACCACGGTCAAGAAAGTAGTGAAGACTGTGACAACACGGACAGTACAGCCAGTCGCTATGGGACCAGACGGGTTGCCTGTGGATGCTTCATCAGTTTCTAACAACTATATCCAGACTTTGGGTCGTGATTTCCGCAAGAATGGCAATGGGGGACCTGGTCCCTATGTGGGGCAAGCTGGCACTGCTACCCTTCCTAGGAACTTCCACTACCCTCCTGATGGTTATAGTCGCCACTATGAAGATGGTTATCCAGGTGGCAGTGATAACTATGGCAGTCTGTCCCGGGTGACCCGCATTGAGGAGCGGTATAGGCCCAGCATGGAAGGCTACCGGGCACCTAGTAGACAGGATGTGTATGGGCCCCAACCCCAGGTTCGGGTAGGTGGGAGCAGCGTGGATCTGCATCGCTTTCATCCAGAGCCTTATGGGCTAGAGGATGACCAGCGTAGTATGGGCTATGATGACCTGGATTATGGTATGATGTCTGATTATGGCACTGCCCGTCGGACTGGGACACCCTCTGACCCTCGTCGGCGCCTCAGGAGCTATGAAGACATGATTGGTGAGGAGGTGCCATCGGATCAATACTACTGGGCTCCTTTGGCCCAGCATGAGCGAGGAAGTTTAGCAAGCTTGGATAGCCTGCGCAAAGGAGGGCCTCCACCTCCTAATTGGAGACAGCCAGAGCTGCCAGAGGTGATCGCCATGCTTGGATTCCGCTTGGATGCTGTCAAGTCCAATGCAGCTGCATACCTGCAACACTTATGCTACCGCAATGACAAGGTGAAGACTGACGTGCGGAAGCTCAAGGGCATCCCAGTACTGGTGGGATTGTTAGACCATCCCAAAAAGGAAGTGCACCTTGGAGCCTGTGGAGCTCTCAAGAATATCTCTTTTGGACGTGACCAGGATAACAAGATTGCCATAAAAAACTGTGATGGTGTGCCTGCCCTTGTGCGATTGCTTCGAAAGGCTCGTGATATGGACCTTACTGAAGTTATTACCGGAACCCTGTGGAATCTTTCATCCCATGACTCAATCAAAATGGAGATTGTGGACCATGCACTGCATGCCTTGACAGATGAAGTGATCATTCCTCATTCTGGTTGGGAGCGGGAACCTAATGAAGACTGTAAGCCACGCCATATTGAGTGGGAATCGGTGCTCACCAACACAGCTGGCTGCCTTAGGAATGTAAGCTCAGAGAGGAGTGAAGCTCGCCGGAAACTTCGGGAATGTGATGGTTTAGTTGATGCCCTCATTTTCATTGTTCAGGCTGAGATTGGGCAGAAGGATTCAGACAGCAAGCTTGTAGAGAACTGTGTTTGCCTTCTTCGGAACTTATCATATCAAGTTCACCGGGAGATCCCACAGGCAGAGCGTTACCAAGAGGCAGCTCCCAATGTTGCCAACAATACTGGGCCACATGCTGCCAGTTGCTTTGGGGCCAAGAAGGGCAAAGGGAAAAAACCTATAGAGGATCCAGCAAACGATACAGTGGATTTCCCTAAAAGAACGAGTCCAGCTCGAGGCTATGAGCTCTTATTTCAGCCAGAGGTGGTTCGGATATACATCTCACTTCTTAAGGAGAGCAAGACTCCTGCCATCCTAGAAGCCTCAGCTGGAGCTATCCAGAACTTGTGTGCTGGGCGCTGGACGTATGGTCGATACATCCGCTCTGCTCTGCGTCAAGAGAAGGCTCTTTCTGCCATAGCTGACCTCCTGACTAATGAACATGAACGGGTGGTGAAAGCTGCATCTGGAGCACTGAGAAACCTGGCTGTGGATGCTCGCAACAAAGAATTAATTGGTAAACATGCTATTCCTAACTTGGTAAAGAATCTGCCAGGAGGACAGCAGAACTCCTCTTGGAATTTCTCTGAGGACACTGTCATCTCTATTTTGAACACTATCAACGAGGTTATCGCTGAGAACTTGGAGGCTGCCAAAAAGCTTCGAGAGACACAGGGTATTGAGAAGCTGGTGTTGATCAACAAATCAGGGAACCGCTCAGAAAAAGAAGTTCGAGCAGCAGCACTTGTATTACAGACAATCTGGGGATATAAGGAACTGCGGAAGCCACTGGAAAAAGAAGGATGGAAGAAATCAGACTTTCAGGTGAATCTAAACAATGCTTCCCGAAGCCAGAGCAGTCATTCATATGATGATAGTACTCTCCCTCTCATTGACCGGAACCAAAAATCAGATAAGAAACCTGATCGGGAAGAAATTCAGATGAGCAATATGGGATCAAACACAAAATCACTAGATAACAACTATTCCACACCAAATGAGAGAGGAGACCACAATAAAACACTGGATCGATCGGGGGATCTAGGCGACATGGAGCCATTGAAGGGAACAACACCCTTGATGCAGAAGATTTAGCACCACTATCTCCGTTCCATCTGGGCTTATATGTACTTTTATTTTTTGGTGGTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

Insert Property: Insert 1

Type Value Extra Information
CDS Start <1
CDS Stop 2494

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

AGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGAGCTTGCAATTCGCGCGTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTAGTACGAGGCCCTTTCACTCATTAGATGCATGTCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGGACTCTAGCCTAGGCCGCGGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATTAGGCCTATTTAGGTGACACTATAGAACAAGTTTGTACAAAAAAGCAGGCTGGTACCGGTCCGGAATTCCCGGGATATCGTCGACCCACGCGTCCGGGAGCCGGGGCAGATTGTGGAGACCTACACGGAGGAGGATCCTGAGGGAGCCATGTCTGTAGTCTCTGTGGAGACCTCAGATGATGGGACCACTCGGCGCACAGAGACCACGGTCAAGAAAGTAGTGAAGACTGTGACAACACGGACAGTACAGCCAGTCGCTATGGGACCAGACGGGTTGCCTGTGGATGCTTCATCAGTTTCTAACAACTATATCCAGACTTTGGGTCGTGATTTCCGCAAGAATGGCAATGGGGGACCTGGTCCCTATGTGGGGCAAGCTGGCACTGCTACCCTTCCTAGGAACTTCCACTACCCTCCTGATGGTTATAGTCGCCACTATGAAGATGGTTATCCAGGTGGCAGTGATAACTATGGCAGTCTGTCCCGGGTGACCCGCATTGAGGAGCGGTATAGGCCCAGCATGGAAGGCTACCGGGCACCTAGTAGACAGGATGTGTATGGGCCCCAACCCCAGGTTCGGGTAGGTGGGAGCAGCGTGGATCTGCATCGCTTTCATCCAGAGCCTTATGGGCTAGAGGATGACCAGCGTAGTATGGGCTATGATGACCTGGATTATGGTATGATGTCTGATTATGGCACTGCCCGTCGGACTGGGACACCCTCTGACCCTCGTCGGCGCCTCAGGAGCTATGAAGACATGATTGGTGAGGAGGTGCCATCGGATCAATACTACTGGGCTCCTTTGGCCCAGCATGAGCGAGGAAGTTTAGCAAGCTTGGATAGCCTGCGCAAAGGAGGGCCTCCACCTCCTAATTGGAGACAGCCAGAGCTGCCAGAGGTGATCGCCATGCTTGGATTCCGCTTGGATGCTGTCAAGTCCAATGCAGCTGCATACCTGCAACACTTATGCTACCGCAATGACAAGGTGAAGACTGACGTGCGGAAGCTCAAGGGCATCCCAGTACTGGTGGGATTGTTAGACCATCCCAAAAAGGAAGTGCACCTTGGAGCCTGTGGAGCTCTCAAGAATATCTCTTTTGGACGTGACCAGGATAACAAGATTGCCATAAAAAACTGTGATGGTGTGCCTGCCCTTGTGCGATTGCTTCGAAAGGCTCGTGATATGGACCTTACTGAAGTTATTACCGGAACCCTGTGGAATCTTTCATCCCATGACTCAATCAAAATGGAGATTGTGGACCATGCACTGCATGCCTTGACAGATGAAGTGATCATTCCTCATTCTGGTTGGGAGCGGGAACCTAATGAAGACTGTAAGCCACGCCATATTGAGTGGGAATCGGTGCTCACCAACACAGCTGGCTGCCTTAGGAATGTAAGCTCAGAGAGGAGTGAAGCTCGCCGGAAACTTCGGGAATGTGATGGTTTAGTTGATGCCCTCATTTTCATTGTTCAGGCTGAGATTGGGCAGAAGGATTCAGACAGCAAGCTTGTAGAGAACTGTGTTTGCCTTCTTCGGAACTTATCATATCAAGTTCACCGGGAGATCCCACAGGCAGAGCGTTACCAAGAGGCAGCTCCCAATGTTGCCAACAATACTGGGCCACATGCTGCCAGTTGCTTTGGGGCCAAGAAGGGCAAAGGGAAAAAACCTATAGAGGATCCAGCAAACGATACAGTGGATTTCCCTAAAAGAACGAGTCCAGCTCGAGGCTATGAGCTCTTATTTCAGCCAGAGGTGGTTCGGATATACATCTCACTTCTTAAGGAGAGCAAGACTCCTGCCATCCTAGAAGCCTCAGCTGGAGCTATCCAGAACTTGTGTGCTGGGCGCTGGACGTATGGTCGATACATCCGCTCTGCTCTGCGTCAAGAGAAGGCTCTTTCTGCCATAGCTGACCTCCTGACTAATGAACATGAACGGGTGGTGAAAGCTGCATCTGGAGCACTGAGAAACCTGGCTGTGGATGCTCGCAACAAAGAATTAATTGGTAAACATGCTATTCCTAACTTGGTAAAGAATCTGCCAGGAGGACAGCAGAACTCCTCTTGGAATTTCTCTGAGGACACTGTCATCTCTATTTTGAACACTATCAACGAGGTTATCGCTGAGAACTTGGAGGCTGCCAAAAAGCTTCGAGAGACACAGGGTATTGAGAAGCTGGTGTTGATCAACAAATCAGGGAACCGCTCAGAAAAAGAAGTTCGAGCAGCAGCACTTGTATTACAGACAATCTGGGGATATAAGGAACTGCGGAAGCCACTGGAAAAAGAAGGATGGAAGAAATCAGACTTTCAGGTGAATCTAAACAATGCTTCCCGAAGCCAGAGCAGTCATTCATATGATGATAGTACTCTCCCTCTCATTGACCGGAACCAAAAATCAGATAAGAAACCTGATCGGGAAGAAATTCAGATGAGCAATATGGGATCAAACACAAAATCACTAGATAACAACTATTCCACACCAAATGAGAGAGGAGACCACAATAAAACACTGGATCGATCGGGGGATCTAGGCGACATGGAGCCATTGAAGGGAACAACACCCTTGATGCAGAAGATTTAGCACCACTATCTCCGTTCCATCTGGGCTTATATGTACTTTTATTTTTTGGTGGTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGCGGCCGCTCTAGAGTATCCCTCGAGGGGCCCAAGCTTACGCGTACCCAGCTTTCTTGTACAAAGTGGTCCCTATAGTGAGTCGTATTATAAGCTAGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACTGCTAGCTTGGGATCTTTGTGAAGGAACCTTACTTCTGTGGTGTGACATAATTGGACAAACTACCTACAGAGATTTAAAGCTCTAAGGTAAATATAAAATTTTTAAGTGTATAATGTGTTAAACTAGCTGCATATGCTTGCTGCTTGAGAGTTTTGCTTACTGAGTATGATTTATGAAAATATTATACACAGGAGCTAGTGATTCTAATTGTTTGTGTATTTTAGATTCACAGTCCCAAGGCTCATTTCAGGCCCCTCAGTCCTCACAGTCTGTTCATGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCGATCCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGCCAGGTCTTGGACTGGTGAGAACGGCTTGCTCGGCAGCTTCGATGTGTGCTGGAGGGAGAATAAAGGTCTAAGATGTGCGATAGAGGGAAGTCGCATTGAATTATGTGCTGTGTAGGGATCGCTGGTATCAAATATGTGTGCCCACCCCTGGCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGCCATAACTTCGTATAATGTATGCTATACGAAGTTATGGCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAA

Sequencing Information:

Phred Score: 895
Date: 2017-01-25

Last Passing Sequencing Read:

>26606-48_HsCD00324018-CMV-F_H6 895 1389 35 922 NNNTTTACATGCGCATAGCAACTCGTTAGTGACCGTCAGATCGCCTGGAG ACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCA GCCTCCGGACTCTAGCCTAGGCCGCGGGACGGATAACAATTTCACACAGG AAACAGCTATGACCATTAGGCCTATTTAGGTGACACTATAGAACAAGTTT GTACAAAAAAGCAGGCTGGTACCGGTCCGGAATTCCCGGGATATCGTCGA CCCACGCGTCCGGGAGCCGGGGCAGATTGTGGAGACCTACACGGAGGAGG ATCCTGAGGGAGCCATGTCTGTAGTCTCTGTGGAGACCTCAGATGATGGG ACCACTCGGCGCACAGAGACCACGGTCAAGAAAGTAGTGAAGACTGTGAC AACACGGACAGTACAGCCAGTCGCTATGGGACCAGACGGGTTGCCTGTGG ATGCTTCATCAGTTTCTAACAACTATATCCAGACTTTGGGTCGTGATTTC CGCAAGAATGGCAATGGGGGACCTGGTCCCTATGTGGGGCAAGCTGGCAC TGCTACCCTTCCTAGGAACTTCCACTACCCTCCTGATGGTTATAGTCGCC ACTATGAAGATGGTTATCCAGGTGGCAGTGATAACTATGGCAGTCTGTCC CGGGTGACCCGCATTGAGGAGCGGTATAGGCCCAGCATGGAAGGCTACCG GGCACCTAGTAGACAGGATGTGTATGGGCCCCAACCCCAGGTTCGGGTAG GTGGGAGCAGCGTGGATCTGCATCGCTTTCATCCAGAGCCTTATGGGCTA GAGGATGACCAGCGTAGTATGGGCTATGATGACCTGGATTATGGTATGAT GTCTGATTATGGCACTGCCCGTCGGACTGGGACACCCTCTGACCCTCGTC GGCGCCTCAGGAGCTATGAAGACATGATTGGGTGAGAGGTGCCCATCGNA TCATACTACTGGGCTCCTTTGGNCCAGCATGAGCGAGGAAGTTTNAGCAG CTGGATACCTGCGCAAAGGAGGCCTCCCACTCTANTGGAGACAGCCGAGC TGCCAGAGTGATCGCCATGCTGGATCCGCTTGNAGCTGTCAGTCCATGCA GCTGCATACTGCACACTATGCTACGCATGAACAGTGNAACGACNTGCGAC TCAGGNCATCCAGTATGGTGGGATGTAGACATCCAAAAAGAATGCCCTGG ACCGGGAACTTCAAAATTCCTTTGACTGACGGATACAAATGCCAAAAACG GAAGGGGCCGCCTGGGCATGCTCAAAGCCGGATGGACTTCGGAATTTCGG ACCGGGGACTCCCCGACCCAAAAGAATGGCAACCCCCCCTCCAAAGGACT

Vector Information:

Vector Name:pCMV-SPORT6
Type:bacterial plasmid
Description:Clone with T7, SP6, and CMV promoters and LoxP site. ampicillin resistance in bacteria
Properties:loxP
Comments:An MluI site is introduced upon ligation of a cDNA insert. "pCMV-SPORT6 Library Method Overview: Prior to January 2001, Life Technologies, Invitrogen Corp., Carlsbad, CA, constructed non-normalized (standard) libraries in the pCMV-SPORT6 vector. Briefly, the library method was as follows: First strand cDNA was synthesized from polyA+mRNA using Invitrogen Superscript II RT and an oligo-dT primer containing a Not I site. Second strand cDNA was synthesized. Sal I adapters were ligated onto the double stranded cDNA which was then digested with Not I creating 5'-Sal I/3'- Not I inserts. This cDNA was size-fractionated on a column and ligated into the pCMV-Sport6 vector." http://mgc.nci.nih.gov/Vectors/prot_pcmv-sport6
Map:pcmv-sport6.gif
Sequence:pCMV_Sport_6.txt
Size (bp):4396
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
MGC Consortium