Clone: HsCD00297205

Clone ID:HsCD00297205
Is Verified:Y
Status:AVAILABLE
Source:The ORFeome Collaboration
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

HIP Master Clone ID 201475
HIP Clone ID 269973
Original Clone ID FLH269973.01L
IMAGE ID 100058816

Property:

Collection: NIH_MGC_425
Collection: OCAB16
Collection: The ORFeome Collaboration

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 3324 Homo sapiens FUSION 2986 GUCY2F guanylate cyclase 2F, retinal
Insert1
Size (bp)3324
SpeciesHomo sapiens
FormatFUSION
Tissue Source
Species Specific ID 2986
Gene SymbolGUCY2F
Gene Nameguanylate cyclase 2F, retinal
Keyword

Insert Sequence:

ATGTTCCTGGGACTCGGGCGCTTTTCTCGCCTTGTTCTCTGGTTTGCGGCTTTCAGGAAACTGCTGGGACACCATGGCCTTGCATCTGCCAAGTTCCTGTGGTGCTTGTGCCTTCTGTCTGTCATGTCCCTTCCGCAGCAGGTGTGGACACTCCCCTACAAGATAGGGGTGGTGGGCCCTTGGGCTTGTGATTCGCTGTTTTCAAAGGCCCTGCCTGAGGTTGCTGCGCGATTAGCCATTGAGCGAATCAACCGGGACCCATCTTTTGACCTGAGTTATTCTTTTGAATACGTGATTCTCAATGAAGACTGCCAGACTTCGAGGGCTCTCTCCAGTTTCATTTCCCACCACCAGATGGCCTCAGGATTTATTGGACCTACCAACCCTGGCTACTGCGAGGCAGCCTCGCTCCTGGGAAACAGCTGGGACAAAGGAATTTTCTCTTGGGCTTGTGTGAATTATGAATTAGACAATAAAATTAGCTACCCGACCTTTTCTCGGACACTCCCTTCTCCCATCCGGGTGCTTGTAACTGTCATGAAATATTTCCAGTGGGCTCATGCTGGAGTCATTTCCTCAGATGAAGACATTTGGGTGCATACAGCCAATCGAGTCGCAAGTGCTCTTCGGAGCCACGGCTTACCTGTAGGGGTCGTCCTGACCACAGGACAAGACAGCCAAAGCATGCGGAAAGCCCTCCAGAGGATTCACCAGGCAGACAGAATTCGCATAATCATCATGTGTATGCATTCAGCTTTGATTGGGGGAGAGACTCAGATGCATCTCTTGGAATGTGCTCATGATCTGAAAATGACTGATGGAACCTACGTCTTTGTTCCTTATGATGCCCTGCTCTACAGTTTACCTTATAAGCACACCCCCTACCGGGTCCTAAGGAACAACCCAAAGCTCCGGGAAGCCTATGATGCAGTGTTGACCATTACAGTGGAGTCCCAAGAAAAGACCTTCTATCAAGCCTTCACAGAGGCAGCAGCAAGAGGTGAAATTCCTGAGAAGCTGGAGTTCGATCAAGTTTCACCGTTGTTTGGAACCATCTACAATTCAATTTACTTTATCGCACAAGCCATGAATAATGCTATGAAAGAAAATGGACAGGCTGGTGCTGCCAGCCTGGTTCAGCATTCCAGAAACATGCAGTTCCATGGATTCAACCAGTTGATGAGGACAGATTCAAATGGAAATGGAATTTCAGAATATGTAATCCTGGACACCAACTTGAAAGAATGGGAACTCCATAGCACCTACACTGTGGACATGGAAATGGAGCTGCTACGTTTCGGAGGGACCCCTATTCACTTCCCTGGTGGCAGGCCCCCTAGAGCAGATGCAAAATGCTGGTTTGCAGAAGGGAAGATCTGCCATGGAGGCATCGACCCTGCCTTTGCCATGATGGTCTGCCTTACTTTGCTTATAGCCCTGCTGTCTATTAATGGATTTGCTTACTTTATAAGGCGTCGTATAAATAAAATCCAGTTGATCAAAGGACCCAATAGAATTCTACTGACTTTGGAGGATGTAACGTTTATCAATCCCCACTTTGGCAGTAAGAGAGGAAGTCGTGCCAGTGTAAGCTTCCAGATTACCTCAGAGGTCCAAAGTGGGAGGTCCCCAAGACTCTCCTTTTCTTCAGGGAGTCTAACTCCAGCTACCTATGAAAACTCCAACATAGCGATTTATGAGGGTGATTGGGTGTGGCTGAAAAAGTTCTCCCTTGGAGATTTTGGAGACCTTAAGTCCATCAAATCAAGAGCAAGTGATGTGTTCGAAATGATGAAGGACTTGCGTCATGAGAATATTAACCCTTTATTGGGTTTCTTCTATGATTCGGGGATGTTTGCCATTGTGACAGAATTCTGTTCCCGAGGGAGCCTAGAAGACATACTGACAAATCAAGATGTGAAACTTGACTGGATGTTTAAATCATCACTCTTGCTGGATCTCATAAAGGGCATGAAGTACTTACACCACAGAGAGTTTGTTCATGGGAGGCTAAAGTCTCGAAACTGTGTGGTAGATGGGCGTTTTGTACTAAAAGTGACAGATTATGGCTTTAACGACATCTTAGAAATGCTGAGACTCTCTGAAGAGGAATCTTCTATGGAAGAGCTGCTGTGGACGGCCCCTGAACTGTTGAGAGCTCCAAGAGGCAGCAGGTTAGGTTCTTTTGCAGGAGATGTCTATAGCTTTGCCATCATCATGCAAGAAGTGATGGTCCGGGGTACCCCATTCTGCATGATGGATCTGCCAGCTCAAGAAATCATAAACAGACTTAAGAAGCCTCCTCCTGTGTACAGACCAGTAGTTCCTCCTGAGCATGCCCCTCCAGAATGTCTCCAGCTGATGAAGCAGTGCTGGGCTGAGGCTGCAGAACAACGACCAACTTTTGATGAAATATTTAACCAGTTTAAAACTTTTAATAAAGGGAAGAAGACCAATATTATTGATTCTATGCTTCGGATGTTGGAGCAATATTCTAGCAACTTGGAAGATTTGATTCGGGAGCGGACTGAAGAGCTGGAAATTGAAAAACAGAAAACGGAAAAGCTTCTAACACAGATGCTACCACCATCAGTTGCTGAATCTCTCAAAAAGGGCTGCACAGTTGAACCTGAGGGCTTTGACTTGGTCACCTTGTACTTCAGCGACATTGTGGGCTTCACAACCATTTCAGCCATGAGTGAGCCCATTGAGGTCGTGGATCTTCTGAATGACCTGTACACACTCTTTGATGCAATAATTGGCAGTCATGATGTCTACAAGGTAGAGACCATTGGAGATGCCTACATGGTGGCTTCAGGCCTCCCAAAGAGGAATGGCAGTAGGCATGCAGCTGAGATTGCAAACATGTCCTTAGATATCCTGAGCTCTGTGGGCACTTTCAAGATGCGGCACATGCCAGAAGTGCCGGTCCGAATTCGAATTGGCCTTCACTCAGGGCCGGTTGTTGCTGGAGTGGTGGGCCTCACCATGCCCAGATACTGCTTGTTTGGAGACACTGTGAACACAGCTTCTCGGATGGAATCTACAGGCTTACCTTATCGCATTCATGTCAGTCTCAGCACTGTTACAATTCTTCAAAATCTGAGTGAGGGCTATGAAGTGGAGCTTCGAGGAAGAACAGAGCTCAAGGGCAAAGGCACAGAGGAAACCTTCTGGCTGATTGGGAAAAAAGGCTTCATGAAGCCCCTTCCTGTGCCCCCACCAGTGGACAAAGATGGGCAAGTGGGCCATGGCCTGCAACCAGTGGAGATTGCAGCCTTCCAAAGAAGAAAAGCAGAAAGGCAGTTGGTGAGAAACAAGCCA

Insert Property: Insert 1

Type Value Extra Information
CDS Start 1
CDS Stop 3324
End on reference sequence 3603
Start on reference sequence 277

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGTTCCTGGGACTCGGGCGCTTTTCTCGCCTTGTTCTCTGGTTTGCGGCTTTCAGGAAACTGCTGGGACACCATGGCCTTGCATCTGCCAAGTTCCTGTGGTGCTTGTGCCTTCTGTCTGTCATGTCCCTTCCGCAGCAGGTGTGGACACTCCCCTACAAGATAGGGGTGGTGGGCCCTTGGGCTTGTGATTCGCTGTTTTCAAAGGCCCTGCCTGAGGTTGCTGCGCGATTAGCCATTGAGCGAATCAACCGGGACCCATCTTTTGACCTGAGTTATTCTTTTGAATACGTGATTCTCAATGAAGACTGCCAGACTTCGAGGGCTCTCTCCAGTTTCATTTCCCACCACCAGATGGCCTCAGGATTTATTGGACCTACCAACCCTGGCTACTGCGAGGCAGCCTCGCTCCTGGGAAACAGCTGGGACAAAGGAATTTTCTCTTGGGCTTGTGTGAATTATGAATTAGACAATAAAATTAGCTACCCGACCTTTTCTCGGACACTCCCTTCTCCCATCCGGGTGCTTGTAACTGTCATGAAATATTTCCAGTGGGCTCATGCTGGAGTCATTTCCTCAGATGAAGACATTTGGGTGCATACAGCCAATCGAGTCGCAAGTGCTCTTCGGAGCCACGGCTTACCTGTAGGGGTCGTCCTGACCACAGGACAAGACAGCCAAAGCATGCGGAAAGCCCTCCAGAGGATTCACCAGGCAGACAGAATTCGCATAATCATCATGTGTATGCATTCAGCTTTGATTGGGGGAGAGACTCAGATGCATCTCTTGGAATGTGCTCATGATCTGAAAATGACTGATGGAACCTACGTCTTTGTTCCTTATGATGCCCTGCTCTACAGTTTACCTTATAAGCACACCCCCTACCGGGTCCTAAGGAACAACCCAAAGCTCCGGGAAGCCTATGATGCAGTGTTGACCATTACAGTGGAGTCCCAAGAAAAGACCTTCTATCAAGCCTTCACAGAGGCAGCAGCAAGAGGTGAAATTCCTGAGAAGCTGGAGTTCGATCAAGTTTCACCGTTGTTTGGAACCATCTACAATTCAATTTACTTTATCGCACAAGCCATGAATAATGCTATGAAAGAAAATGGACAGGCTGGTGCTGCCAGCCTGGTTCAGCATTCCAGAAACATGCAGTTCCATGGATTCAACCAGTTGATGAGGACAGATTCAAATGGAAATGGAATTTCAGAATATGTAATCCTGGACACCAACTTGAAAGAATGGGAACTCCATAGCACCTACACTGTGGACATGGAAATGGAGCTGCTACGTTTCGGAGGGACCCCTATTCACTTCCCTGGTGGCAGGCCCCCTAGAGCAGATGCAAAATGCTGGTTTGCAGAAGGGAAGATCTGCCATGGAGGCATCGACCCTGCCTTTGCCATGATGGTCTGCCTTACTTTGCTTATAGCCCTGCTGTCTATTAATGGATTTGCTTACTTTATAAGGCGTCGTATAAATAAAATCCAGTTGATCAAAGGACCCAATAGAATTCTACTGACTTTGGAGGATGTAACGTTTATCAATCCCCACTTTGGCAGTAAGAGAGGAAGTCGTGCCAGTGTAAGCTTCCAGATTACCTCAGAGGTCCAAAGTGGGAGGTCCCCAAGACTCTCCTTTTCTTCAGGGAGTCTAACTCCAGCTACCTATGAAAACTCCAACATAGCGATTTATGAGGGTGATTGGGTGTGGCTGAAAAAGTTCTCCCTTGGAGATTTTGGAGACCTTAAGTCCATCAAATCAAGAGCAAGTGATGTGTTCGAAATGATGAAGGACTTGCGTCATGAGAATATTAACCCTTTATTGGGTTTCTTCTATGATTCGGGGATGTTTGCCATTGTGACAGAATTCTGTTCCCGAGGGAGCCTAGAAGACATACTGACAAATCAAGATGTGAAACTTGACTGGATGTTTAAATCATCACTCTTGCTGGATCTCATAAAGGGCATGAAGTACTTACACCACAGAGAGTTTGTTCATGGGAGGCTAAAGTCTCGAAACTGTGTGGTAGATGGGCGTTTTGTACTAAAAGTGACAGATTATGGCTTTAACGACATCTTAGAAATGCTGAGACTCTCTGAAGAGGAATCTTCTATGGAAGAGCTGCTGTGGACGGCCCCTGAACTGTTGAGAGCTCCAAGAGGCAGCAGGTTAGGTTCTTTTGCAGGAGATGTCTATAGCTTTGCCATCATCATGCAAGAAGTGATGGTCCGGGGTACCCCATTCTGCATGATGGATCTGCCAGCTCAAGAAATCATAAACAGACTTAAGAAGCCTCCTCCTGTGTACAGACCAGTAGTTCCTCCTGAGCATGCCCCTCCAGAATGTCTCCAGCTGATGAAGCAGTGCTGGGCTGAGGCTGCAGAACAACGACCAACTTTTGATGAAATATTTAACCAGTTTAAAACTTTTAATAAAGGGAAGAAGACCAATATTATTGATTCTATGCTTCGGATGTTGGAGCAATATTCTAGCAACTTGGAAGATTTGATTCGGGAGCGGACTGAAGAGCTGGAAATTGAAAAACAGAAAACGGAAAAGCTTCTAACACAGATGCTACCACCATCAGTTGCTGAATCTCTCAAAAAGGGCTGCACAGTTGAACCTGAGGGCTTTGACTTGGTCACCTTGTACTTCAGCGACATTGTGGGCTTCACAACCATTTCAGCCATGAGTGAGCCCATTGAGGTCGTGGATCTTCTGAATGACCTGTACACACTCTTTGATGCAATAATTGGCAGTCATGATGTCTACAAGGTAGAGACCATTGGAGATGCCTACATGGTGGCTTCAGGCCTCCCAAAGAGGAATGGCAGTAGGCATGCAGCTGAGATTGCAAACATGTCCTTAGATATCCTGAGCTCTGTGGGCACTTTCAAGATGCGGCACATGCCAGAAGTGCCGGTCCGAATTCGAATTGGCCTTCACTCAGGGCCGGTTGTTGCTGGAGTGGTGGGCCTCACCATGCCCAGATACTGCTTGTTTGGAGACACTGTGAACACAGCTTCTCGGATGGAATCTACAGGCTTACCTTATCGCATTCATGTCAGTCTCAGCACTGTTACAATTCTTCAAAATCTGAGTGAGGGCTATGAAGTGGAGCTTCGAGGAAGAACAGAGCTCAAGGGCAAAGGCACAGAGGAAACCTTCTGGCTGATTGGGAAAAAAGGCTTCATGAAGCCCCTTCCTGTGCCCCCACCAGTGGACAAAGATGGGCAAGTGGGCCATGGCCTGCAACCAGTGGAGATTGCAGCCTTCCAAAGAAGAAAAGCAGAAAGGCAGTTGGTGAGAAACAAGCCATCAGGCCTCATGGGCCCAGCTTTCTTGTACAAAGTTGGCATTATAAAAAATAATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGCCTCCTCTAGACCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTGCCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAACCCTCGAGCCACCCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCG

Sequencing Information:

Phred Score: 0
Date: 2012-05-31

Last Passing Sequencing Read:

CAANGATTTATTTTGACTGATAGTGACCTGNTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGTTCCTGGGACTCGGGCGCTTTTCTCGCCTTGTTCTCTGGTTTGCGGCTTTCAGGAAACTGCTGGGACACCATGGCCTTGCATCTGCCAAGTTCCTGTGGTGCTTGTGCCTTCTGTCTGTCATGTCCCTTCCGCAGCAGGTGTGGACACTCCCCTACAAGATAGGGGTGGTGGGCCCTTGGGCTTGTGATTCGCTGTTTTCAAAGGCCCTGCCTGAGGTTGCTGCGCGATTAGCCATTGAGCGAATCAACCGGGACCCATCTTTTGACCTGAGTTATTCTTTTGAATACGTGATTCTCAATGAAGACTGCCAGACTTCGAGGGCTCTCTCCAGTTTCATTTCCCACCACCAGATGGCCTCAGGATTTATTGGACCTACCAACCCTGGCTACTGCGAGGCAGCCTCGCTCCTGGGAAACAGCTGGGACAAAGGAATTTTCTCTTGGGCTTGTGTGAATTATGAATTAGACAATAAAATTAGCTACCCGACCTTTTCTCGGACACTCCCTTCTCCCATCCGGGTGCTTGTAACTGTCATGAAATATTTCCAGTGGGCTCATGCTGGAGTCATTTCCTCAGATGAAGACATTTGGGTGCATACAGCCAATCGAGTCGCAAGTGCTCTTCGGAGCCACGGCTTACCTGTAGGGGTCGTCCTGACCACAGGGACAAGACAGCCAAAGCATGCGGAAAGCCCTCCAGAGGATTCACCAGGCAGACAGAATTCGCATAATCATCATGTGTATGCATTCAGCTTTGATTGGGGGAGAGACTCAGANGCATCTCTNGGAATGTGCTCATGATCTGAAAATGACTGATGGAACCTACNTCTTTGTTCCTTATGANGCCCCTGCTCTACAGTTTACCTTATAAGCACACCCCCTACCGGGTCCTAANGAACAACCCNAAAGCTCCGGGAANCCTATGAATGCANNGTTGAACNATTACAGNGGAATCCCAAAAAAAAAACCTTCTAATCANGCCTTCNAANANGCANCANCAAAAGGGGAAAATTCNTGAAAANCTGAANTTCAATCAAGTTNCCCCNGNTGTTTGGAACCCTCTAANAATNCANTTNANTTTATCCCCAAACCCTGAAAAAAGGCTTNAAAAAAAAAAGAAAGGGCNGGGGCTCCCCCCCNGGGTNCAAAATTCCAAAAAATGCNNTTCCTGGGATNCCCCNNTNANGAANANAATTCAANGGAAANGGAATTNNAAANTNNATCNNGGACCCCNTTNAAAAAAGGGAACCCCAACCCNCCCTNGGAANAAAAGNAGTTCNTTTAAAAACCNTNTTTTCCTGGGGGNCCCAAAAAAAAAANGNNTTTAAAAAAANCCCGGAANCNCCCCNTNAGANGNCCNTTTTAACC

Vector Information:

Vector Name:pENTR223.1
Type:bacterial plasmid
Description:Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Properties:Gateway, donor (entry), recombinational cloning
Comments:Additional information about this vector is available from the commercial website and at the ORFeome website http://www.orfeomecollaboration.org/html/vectors.shtml.
Map:pENTR223-1-map.doc
Sequence:pENTR223_1.txt
Size (bp):4311
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial spectinomycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL spectinomycin Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.

Authors:

Author Name Author Type
The ORFeome Collaboration Consortium