Clone: HsCD00296994

Clone ID:HsCD00296994
Is Verified:Y
Status:AVAILABLE
Source:The ORFeome Collaboration
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

IMAGE ID 100067244
HIP Clone ID 483336
Original Clone ID FLH483336.01L
GenBank Accession EU832215
GI 190690020
HIP Master Clone ID 401064

Property:

Collection: DKFZo008
Collection: OCAA107
Collection: The ORFeome Collaboration

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 639 Homo sapiens FUSION 25978 CHMP2B chromatin modifying protein 2B
Insert1
Size (bp)639
SpeciesHomo sapiens
FormatFUSION
Tissue Source
Species Specific ID 25978
Gene SymbolCHMP2B
Gene Namechromatin modifying protein 2B
Keyword

Insert Sequence:

GTACAAAAAAGCAGGCTCCACCATGGCGTCCCTCTTCAAGAAGAAAACCGTGGATGATGTAATAAAGGAACAGAATCGAGAGTTACGAGGTACACAGAGGGCTATAATCAGAGATCGAGCAGCTTTAGAGAAACAAGAAAAACAGCTGGAATTAGAAATTAAGAAAATGGCCAAGATTGGTAATAAGGAAGCTTGCAAAGTTTTAGCCAAACAACTTGTGCATCTACGGAAACAGAAGACGAGAACTTTTGCTGTAAGTTCAAAAGTTACTTCTATGTCTACACAAACAAAAGTGATGAATTCCCAAATGAAGATGGCTGGAGCAATGTCTACCACAGCAAAAACAATGCAGGCAGTTAACAAGAAGATGGATCCACAAAAGACATTACAAACAATGCAGAATTTCCAGAAGGAAAACATGAAAATGGAAATGACTGAAGAAATGATCAATGATACACTTGATGACATCTTTGACGGTTCTGATGACGAAGAAGAAAGCCAGGATATTGTGAATCAAGTTCTTGATGAAATTGGAATTGAAATTTCTGGAAAGATGGCCAAAGCTCCATCAGCTGCTCGAAGCTTACCATCTGCCTCTACTTCAAAGGCTACAATCTCAGATGAAGAGATTGAACGGCAACTCAAGGCTTTAGGAGTAGATTGGATCCACCCAGCTTTCTTGTAC

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 718
Start on reference sequence 77

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCACCATGGCGTCCCTCTTCAAGAAGAAAACCGTGGATGATGTAATAAAGGAACAGAATCGAGAGTTACGAGGTACACAGAGGGCTATAATCAGAGATCGAGCAGCTTTAGAGAAACAAGAAAAACAGCTGGAATTAGAAATTAAGAAAATGGCCAAGATTGGTAATAAGGAAGCTTGCAAAGTTTTAGCCAAACAACTTGTGCATCTACGGAAACAGAAGACGAGAACTTTTGCTGTAAGTTCAAAAGTTACTTCTATGTCTACACAAACAAAAGTGATGAATTCCCAAATGAAGATGGCTGGAGCAATGTCTACCACAGCAAAAACAATGCAGGCAGTTAACAAGAAGATGGATCCACAAAAGACATTACAAACAATGCAGAATTTCCAGAAGGAAAACATGAAAATGGAAATGACTGAAGAAATGATCAATGATACACTTGATGACATCTTTGACGGTTCTGATGACGAAGAAGAAAGCCAGGATATTGTGAATCAAGTTCTTGATGAAATTGGAATTGAAATTTCTGGAAAGATGGCCAAAGCTCCATCAGCTGCTCGAAGCTTACCATCTGCCTCTACTTCAAAGGCTACAATCTCAGATGAAGAGATTGAACGGCAACTCAAGGCTTTAGGAGTAGATTGGATCCACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAATAATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGCTTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGAAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGAATTGGTTAATTGGTTGTAACACTGGCAGAGCATTACGCTGACTTGACGGGACGGCGCAAGCTCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT

Vector Information:

Vector Name:pDONR221
Type:bacterial plasmid
Description:Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Properties:Gateway, donor (entry), recombinational cloning
Comments:The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Map:pdonr221_pdonrzeo_map.pdf
Sequence:pDONR221_FASTA.txt
Size (bp):4762
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 50ug/mL kanamycin Growth with the single antibiotic in LB at 37 degrees is recommended. Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.

Authors:

Author Name Author Type
The ORFeome Collaboration Consortium