Clone: HsCD00296414

Clone ID:HsCD00296414
Is Verified:Y
Status:AVAILABLE
Source:The ORFeome Collaboration
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

HIP Master Clone ID 400484
GenBank Accession EU832410
IMAGE ID 100067439
HIP Clone ID 482756
Original Clone ID FLH482756.01L
GI 190690240

Property:

Collection: DKFZo008
Collection: OCAA109
Collection: The ORFeome Collaboration

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 1938 Homo sapiens FUSION 7465 WEE1 WEE1 homolog (S. pombe)
Insert1
Size (bp)1938
SpeciesHomo sapiens
FormatFUSION
Tissue Source
Species Specific ID 7465
Gene SymbolWEE1
Gene NameWEE1 homolog (S. pombe)
Keyword

Insert Sequence:

GTACAAAAAAGCAGGCTCCACCATGAGCTTCCTGAGCCGACAGCAGCCGCCGCCACCCCGCCGCGCCGGGGCGGCCTGCACCTTGCGGCAGAAGCTGATCTTCTCGCCCTGCAGCGACTGTGAGGAGGAGGAAGAAGAGGAGGAGGAGGAGGGCAGCGGCCACAGCACCGGGGAGGACTCGGCCTTTCAAGAGCCCGACTCGCCGCTGCCGCCCGCGCGGAGCCCCACGGAGCCCGGGCCCGAGCGCCGCCGCTCGCCCGGGCCGGCCCCCGGGAGCCCCGGCGAGCTGGAGGAGGACCTGTTGCTGCCCGGCGCCTGCCCGGGCGCGGACGAGGCGGGCGGTGGGGCGGAGGGCGACTCGTGGGAGGAGGAGGGCTTCGGCTCCTCGTCGCCGGTCAAGTCGCCGGCGGCCCCCTACTTCCTGGGTAGCTCTTTCTCGCCGGTGCGCTGCGGCGGCCCAGGAGATGCGTCGCCGCGGGGTTGCGGGGCGCGCCGGGCGGGCGAAGGCCGCCGCTCGCCGCGGCCGGACCACCCGGGCACCCCGCCACACAAGACCTTCCGCAAGCTGCGACTCTTCGACACCCCGCACACGCCCAAGAGTTTGCTCTCCAAAGCTCGGGGAATTGATTCCAGCTCTGTTAAACTCCGGGGTAGTTCTCTCTTCATGGATACAGAAAAATCAGGAAAAAGGGAATTTGATGTGCGACAGACTCCTCAAGTGAATATTAATCCTTTTACTCCGGATTCTTTGTTGCTTCATTCCTCAGGACAGTGTCGTCGTAGAAAGAGAACGTATTGGAATGATTCCTGTGGTGAAGACATGGAAGCCAGTGATTATGAGCTTGAAGATGAAACAAGACCTGCTAAGAGAATTACAATTACTGAAAGCAATATGAAGTCCCGGTATACAACAGAATTTCATGAGCTAGAGAAAATCGGCTCTGGAGAATTTGGTTCTGTATTTAAGTGTGTGAAGAGGCTGGATGGATGCATTTATGCCATTAAGCGATCAAAAAAGCCATTGGCGGGCTCTGTTGATGAGCAGAACGCTTTGAGAGAAGTATATGCTCATGCAGTGCTTGGACAGCATTCTCATGTAGTTCGATATTTCTCTGCGTGGGCAGAAGATGATCATATGCTTATACAGAATGAATATCGTAATGGTGGAAGTTTAGCTGATGCTATAAGTGAAAACTACAGAATCATGAGTTACTTTAAAGAAGCAGAGTTGAAGGATCTCCTTTTGCAAGTTGGCCGAGGCTTGAGGTATATTCATTCAATGTCTTTGGTTCACATGGATATAAAACCTAGTAATATTTTCATATCTCGAACCTCAATCCCAAATGCTGCCTCTGAAGAAGGAGACGAAGATGATTGGGCATCCAACAAAGTTATGTTTAAAATAGGTGATCTTGGGCATGTAACAAGGATCTCCAGTCCACAAGTTGAAGAGGGCGATAGTCGTTTTCTTGCAAATGAAGTTTTACAGGAGAATTATACCCATCTACCAAAAGCAGATATTTTTGCGCTTGCCCTCACAGTGGTATGTGCTGCTGGTGCTGAACCTCTTCCGAGAAATGGAGATCAATGGCATGAAATCAGACAGGGTAGATTACCTCGGATACCACAAGTGCTTTCCCAAGAATTTACAGAGTTGCTAAAAGTTATGATTCATCCAGATCCAGAGAGAAGACCTTCAGCAATGGCACTGGTAAAGCATTCAGTATTGCTGTCCGCTTCTAGAAAGAGTGCAGAACAATTACGAATAGAATTGAATGCCGAAAAGTTCAAAAATTCACTTTTACAAAAAGAACTCAAGAAAGCACAGATGGCAAAAGCTGCAGCTGAGGAAAGAGCACTCTTCACTGACCGGATGGCCACTAGGTCCACCACCCAGAGTAATAGAACATCTCGACTTATTGGAAAGAAAATGAACCGCTCTGTCAGCCTTACTATATACTGGATCCACCCAGCTTTCTTGTAC

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 1992
Start on reference sequence 52

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCACCATGAGCTTCCTGAGCCGACAGCAGCCGCCGCCACCCCGCCGCGCCGGGGCGGCCTGCACCTTGCGGCAGAAGCTGATCTTCTCGCCCTGCAGCGACTGTGAGGAGGAGGAAGAAGAGGAGGAGGAGGAGGGCAGCGGCCACAGCACCGGGGAGGACTCGGCCTTTCAAGAGCCCGACTCGCCGCTGCCGCCCGCGCGGAGCCCCACGGAGCCCGGGCCCGAGCGCCGCCGCTCGCCCGGGCCGGCCCCCGGGAGCCCCGGCGAGCTGGAGGAGGACCTGTTGCTGCCCGGCGCCTGCCCGGGCGCGGACGAGGCGGGCGGTGGGGCGGAGGGCGACTCGTGGGAGGAGGAGGGCTTCGGCTCCTCGTCGCCGGTCAAGTCGCCGGCGGCCCCCTACTTCCTGGGTAGCTCTTTCTCGCCGGTGCGCTGCGGCGGCCCAGGAGATGCGTCGCCGCGGGGTTGCGGGGCGCGCCGGGCGGGCGAAGGCCGCCGCTCGCCGCGGCCGGACCACCCGGGCACCCCGCCACACAAGACCTTCCGCAAGCTGCGACTCTTCGACACCCCGCACACGCCCAAGAGTTTGCTCTCCAAAGCTCGGGGAATTGATTCCAGCTCTGTTAAACTCCGGGGTAGTTCTCTCTTCATGGATACAGAAAAATCAGGAAAAAGGGAATTTGATGTGCGACAGACTCCTCAAGTGAATATTAATCCTTTTACTCCGGATTCTTTGTTGCTTCATTCCTCAGGACAGTGTCGTCGTAGAAAGAGAACGTATTGGAATGATTCCTGTGGTGAAGACATGGAAGCCAGTGATTATGAGCTTGAAGATGAAACAAGACCTGCTAAGAGAATTACAATTACTGAAAGCAATATGAAGTCCCGGTATACAACAGAATTTCATGAGCTAGAGAAAATCGGCTCTGGAGAATTTGGTTCTGTATTTAAGTGTGTGAAGAGGCTGGATGGATGCATTTATGCCATTAAGCGATCAAAAAAGCCATTGGCGGGCTCTGTTGATGAGCAGAACGCTTTGAGAGAAGTATATGCTCATGCAGTGCTTGGACAGCATTCTCATGTAGTTCGATATTTCTCTGCGTGGGCAGAAGATGATCATATGCTTATACAGAATGAATATCGTAATGGTGGAAGTTTAGCTGATGCTATAAGTGAAAACTACAGAATCATGAGTTACTTTAAAGAAGCAGAGTTGAAGGATCTCCTTTTGCAAGTTGGCCGAGGCTTGAGGTATATTCATTCAATGTCTTTGGTTCACATGGATATAAAACCTAGTAATATTTTCATATCTCGAACCTCAATCCCAAATGCTGCCTCTGAAGAAGGAGACGAAGATGATTGGGCATCCAACAAAGTTATGTTTAAAATAGGTGATCTTGGGCATGTAACAAGGATCTCCAGTCCACAAGTTGAAGAGGGCGATAGTCGTTTTCTTGCAAATGAAGTTTTACAGGAGAATTATACCCATCTACCAAAAGCAGATATTTTTGCGCTTGCCCTCACAGTGGTATGTGCTGCTGGTGCTGAACCTCTTCCGAGAAATGGAGATCAATGGCATGAAATCAGACAGGGTAGATTACCTCGGATACCACAAGTGCTTTCCCAAGAATTTACAGAGTTGCTAAAAGTTATGATTCATCCAGATCCAGAGAGAAGACCTTCAGCAATGGCACTGGTAAAGCATTCAGTATTGCTGTCCGCTTCTAGAAAGAGTGCAGAACAATTACGAATAGAATTGAATGCCGAAAAGTTCAAAAATTCACTTTTACAAAAAGAACTCAAGAAAGCACAGATGGCAAAAGCTGCAGCTGAGGAAAGAGCACTCTTCACTGACCGGATGGCCACTAGGTCCACCACCCAGAGTAATAGAACATCTCGACTTATTGGAAAGAAAATGAACCGCTCTGTCAGCCTTACTATATACTGGATCCACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAATAATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGCTTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGAAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGAATTGGTTAATTGGTTGTAACACTGGCAGAGCATTACGCTGACTTGACGGGACGGCGCAAGCTCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT

Sequencing Information:

Phred Score: 0
Date: 2011-10-20

Last Passing Sequencing Read:

CATATGATTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCACCATGAGCTTCCTGAGCCGACAGCAGCCGCCGCCACCCCGCCGCGCCGGGGCGGCCTGCACCTTGCGGCAGAAGCTGATCTTCTCGCCCTGCAGCGACTGTGAGGAGGAGGAAGAAGAGGAGGAGGAGGAGGGCAGCGGCCACAGCACCGGGGAGGACTCGGCCTTTCAAGAGCCCGACTCGCCGCTGCCGCCCGCGCGGAGCCCCACGGAGCCCGGGCCCGAGCGCCGCCGCTCGCCCGGGCCGGCCCCCGGGAGCCCCGGCGAGCTGGAGGAGGACCTGTTGCTGCCCGGCGCCTGCCCGGGCGCGGACGAGGCGGGCGGTGGGGCGGAGGGCGACTCGTGGGAGGAGGAGGGCTTCGGCTCCTCGTCGCCGGTCAAGTCGCCGGCGGCCCCCTACTTCCTGGGTAGCTCTTTCTCGCNTGGTGCGCTGCNGCGGCCCAGGATATGCNTCGCCNCGGGGTTGCTGGGGCCTTGCNNANTTNNNTNNATNTTGNCNTTTNNTNCTTTTTANNCTANTTTNTCNCTCTNTTTTNNTTNNNTCNTCNNCNCTTNNCGCTNTTTANTCTNTCTTANTCCTCCNTTACTNTTGTTTNNTAATTTTTCTCNCCCNAATNCCTNNNANNNATTTTTNTTTNTNCACCTTTTCACAATNTNCTGCTTTTACTTTCCNCCNCCNTTTTTTTTTCTTNACATNCNTANNCNTCTCCANNCTCNATTNTTTATNTNTNNAATCTTNCCTCCTTCACCTNNAANTCNTCTATCTCNTTTTTCTCCCNCTTTNTCCNNTNCCCTTCTAATCCNCTNTTTNTTTNTTCCNCTNTNTNTCCNCNNTTTNNCTTCTTGTCAANNACCTNTNTNTTNTTTATATAACNNCTCNTCTTTTTTCNTNCTNTNNTTTTTTTNAANATTANTNNCNTNTNTTTTNTTTNANTANNNCGTTCCNTTNCNNNNTCTNNNANTTTTTNNAANTTTNTTCTTTTACNNACTNTTATTTTTTTCCTNCACTCATCCTCTAATNTTGTATCCTNACNNTATTTTATNTNNNCCTTCTCCNATNTNTTTANCTTTNCCTTNNNTGATNNTTTCCNCNAGTTGCTCNTTNNTCTTTTCCNTANNNNCAACNCTCCNNGNTCTTTTTATTTNNTTCNTTCANTATNTNTCACTCNNCNTTTTCCTTCCCTCTCTTCTNTNTTANTNNCTNTTTTCTAGNTCANTTCTCCTTTTTTTNCTATCCTNNTTTNNCNTTTNTCTCANATCCTTCTCACTTACCNCTNNCTCCNCTNTATTNTNTTCTGNTNTTTTTTTCTATTTTTGNNATCNCCTNNCTCNCAANCTNTTTTANATTCNTTNCNNAGTATAGTNATNTCTTTTACNTNGCGNANTACCTTCTATCNNAGNTGTTNANNTNCTNTCNTANTATCTTCTTCNTC

Vector Information:

Vector Name:pDONR221
Type:bacterial plasmid
Description:Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Properties:Gateway, donor (entry), recombinational cloning
Comments:The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Map:pdonr221_pdonrzeo_map.pdf
Sequence:pDONR221_FASTA.txt
Size (bp):4762
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 50ug/mL kanamycin Growth with the single antibiotic in LB at 37 degrees is recommended. Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.

Authors:

Author Name Author Type
The ORFeome Collaboration Consortium