Clone: HsCD00295589

Clone ID:HsCD00295589
Is Verified:Y
Status:AVAILABLE
Source:The ORFeome Collaboration
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

HIP Master Clone ID 399659
IMAGE ID 100066501
HIP Clone ID 481931
Original Clone ID FLH481931.01X
GenBank Accession EU831472
GI 190690768

Property:

Collection: DKFZo004
Collection: OCAA98
Collection: The ORFeome Collaboration

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 2277 Homo sapiens CLOSED 10989 IMMT inner membrane protein, mitochondrial (mitofilin)
Insert1
Size (bp)2277
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 10989
Gene SymbolIMMT
Gene Nameinner membrane protein, mitochondrial (mitofilin)
Keyword

Insert Sequence:

GTACAAAAAAGCAGGCTCCACCATGCTGCGGGCCTGTCAGTTATCGGGTGTGACCGCCGCCGCCCAGAGTTGTCTCTGTGGGAAGTTTGTCCTCCGTCCATTGCGACCATGCCGCAGATACTCTACTTCAGGCAGCTCTGGGTTGACTACTGGCAAAATTGCTGGAGCTGGCCTTTTGTTTGTTGGTGGAGGTATTGGTGGCACTATCCTATATGCCAAATGGGATTCCCATTTCCGGGAAAGTGTAGAGAAAACCATACCTTACTCAGACAAACTCTTCGAGATGGTTCTTGGTCCTGCAGCTTATAATGTTCCATTGCCAAAGAAATCGATTCAGTCGGGTCCACTAAAAATCTCTAGTGTATCAGAAGTAATGAAAGAATCTAAACAGCCTGCCTCACAACTCCAAAAACAAAAGGGAGATACTCCAGCTTCAGCAACAGCACCTACAGAAGCGGCTCAAATTATTTCTGCAGCAGGTGATACCCTGTCGGTCCCAGCCCCTGCAGTTCAGCCTGAGGAATCTTTAAAAACTGATCACCCTGAAATTGGTGAAGGAAAACCCACACCTGCACTTTCAGAAGAAGCATCCTCATCTTCTATAAGGGAGCGACCACCTGAAGAAGTTGCAGCTCGCCTTGCACAACAGGAAAAACAAGAACAAGTTAAAATTGAGTCTCTAGCCAAGAGCTTAGAAGATGCTCTGAGGCAAACTGCAAGTGTCACTCTGCAGGCTATTGCAGCTCAGAATGCTGCGGTCCAGGCTGTCAATGCACACTCCAACATATTGAAAGCCGCCATGGACAATTCTGAGATTGCAGGCGAGAAGAAATCTGCTCAGTGGCGCACAGTGGAGGGTGCATTGAAGGAACGCAGAAAGGCAGTAGATGAAGCTGCCGATGCCCTTCTCAAAGCCAAAGAAGAGTTAGAGAAGATGAAAAGTGTGATTGAAAATGCAAAGAAAAAAGAGGTTGCTGGGGCCAAGCCTCATATAACTGCTGCAGAGGGTAAACTTCACAACATGATAGTTGATCTGGATAATGTGGTCAAAAAGGTCCAAGCAGCTCAGTCTGAGGCTAAGGTTGTATCTCAGTATCATGAGCTGGTGGTCCAAGCTCGGGATGACTTTAAACGAGAGCTGGACAGTATTACTCCAGAAGTCCTTCCTGGGTGGAAAGGAATGAGTGTTTCAGACTTAGCTGACAAGCTCTCTACTGATGATCTGAACTCCCTCATTGCTCATGCACATCGTCGTATTGATCAGCTGAACAGAGAGCTGGCAGAACAGAAGGCCACCGAAAAGCAGCACATCACGTTAGCCTTGGAGAAACAAAAGCTGGAAGAAAAGCGGGCATTTGACTCTGCAGTAGCAAAAGCATTAGAACATCACAGAAGTGAAATACAGGCTGAACAGGACAGAAAGATAGAAGAAGTCAGAGATGCCATGGAAAATGAAATGAGAACCCAGCTTCGCCGACAGGCAGCTGCCCACACTGATCACTTGCGAGATGTCCTTAGGGTACAAGAACAGGAATTGAAGTCTGAATTTGAGCAGAACCTGTCTGAGAAACTCTCTGAACAAGAATTACAATTTCGTCGTCTCAGTCAAGAGCAAGTTGACAACTTTACTCTGGATATAAATACTGCCTATGCCAGACTCAGAGGAATCGAACAGGCTGTTCAGAGCCATGCAGTTGCTGAAGAGGAAGCCAGAAAAGCCCACCAACTCTGGCTTTCAGTGGAGGCATTAAAGTACAGCATGAAGACCTCATCTGCAGAAACACCTACTATCCCGCTGGGTAGTGCGGTTGAGGCCATCAAAGCCAACTGTTCTGATAATGAATTCACCCAAGCTTTAACCGCAGCTATCCCTCCAGAGTCCCTGACCCGTGGGGTGTACAGTGAAGAGACCCTTAGAGCCCGTTTCTATGCTGTTCAAAAACTGGCCCGAAGGGTAGCAATGATTGATGAAACCAGAAATAGCTTGTACCAGTACTTCCTCTCCTACCTACAGTCCCTGCTCCTATTCCCACCTCAGCAACTGAAGCCGCCCCCAGAGCTCTGCCCTGAGGATATAAACACATTTAAATTACTGTCATATGCTTCCTATTGCATTGAGCATGGTGATCTGGAGCTAGCAGCAAAGTTTGTCAATCAGCTGAAGGGGGAATCCAGACGAGTGGCACAGGACTGGCTGAAGGAAGCCCGAATGACCCTAGAAACGAAACAGATAGTGGAAATCCTGACAGCATATGCCAGCGCCGTAGGAATAGGAACCACTCAGGTGCAGCCAGAGTGAATCCACCCAGCTTTCTTGTAC

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 2306
Start on reference sequence 30

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCACCATGCTGCGGGCCTGTCAGTTATCGGGTGTGACCGCCGCCGCCCAGAGTTGTCTCTGTGGGAAGTTTGTCCTCCGTCCATTGCGACCATGCCGCAGATACTCTACTTCAGGCAGCTCTGGGTTGACTACTGGCAAAATTGCTGGAGCTGGCCTTTTGTTTGTTGGTGGAGGTATTGGTGGCACTATCCTATATGCCAAATGGGATTCCCATTTCCGGGAAAGTGTAGAGAAAACCATACCTTACTCAGACAAACTCTTCGAGATGGTTCTTGGTCCTGCAGCTTATAATGTTCCATTGCCAAAGAAATCGATTCAGTCGGGTCCACTAAAAATCTCTAGTGTATCAGAAGTAATGAAAGAATCTAAACAGCCTGCCTCACAACTCCAAAAACAAAAGGGAGATACTCCAGCTTCAGCAACAGCACCTACAGAAGCGGCTCAAATTATTTCTGCAGCAGGTGATACCCTGTCGGTCCCAGCCCCTGCAGTTCAGCCTGAGGAATCTTTAAAAACTGATCACCCTGAAATTGGTGAAGGAAAACCCACACCTGCACTTTCAGAAGAAGCATCCTCATCTTCTATAAGGGAGCGACCACCTGAAGAAGTTGCAGCTCGCCTTGCACAACAGGAAAAACAAGAACAAGTTAAAATTGAGTCTCTAGCCAAGAGCTTAGAAGATGCTCTGAGGCAAACTGCAAGTGTCACTCTGCAGGCTATTGCAGCTCAGAATGCTGCGGTCCAGGCTGTCAATGCACACTCCAACATATTGAAAGCCGCCATGGACAATTCTGAGATTGCAGGCGAGAAGAAATCTGCTCAGTGGCGCACAGTGGAGGGTGCATTGAAGGAACGCAGAAAGGCAGTAGATGAAGCTGCCGATGCCCTTCTCAAAGCCAAAGAAGAGTTAGAGAAGATGAAAAGTGTGATTGAAAATGCAAAGAAAAAAGAGGTTGCTGGGGCCAAGCCTCATATAACTGCTGCAGAGGGTAAACTTCACAACATGATAGTTGATCTGGATAATGTGGTCAAAAAGGTCCAAGCAGCTCAGTCTGAGGCTAAGGTTGTATCTCAGTATCATGAGCTGGTGGTCCAAGCTCGGGATGACTTTAAACGAGAGCTGGACAGTATTACTCCAGAAGTCCTTCCTGGGTGGAAAGGAATGAGTGTTTCAGACTTAGCTGACAAGCTCTCTACTGATGATCTGAACTCCCTCATTGCTCATGCACATCGTCGTATTGATCAGCTGAACAGAGAGCTGGCAGAACAGAAGGCCACCGAAAAGCAGCACATCACGTTAGCCTTGGAGAAACAAAAGCTGGAAGAAAAGCGGGCATTTGACTCTGCAGTAGCAAAAGCATTAGAACATCACAGAAGTGAAATACAGGCTGAACAGGACAGAAAGATAGAAGAAGTCAGAGATGCCATGGAAAATGAAATGAGAACCCAGCTTCGCCGACAGGCAGCTGCCCACACTGATCACTTGCGAGATGTCCTTAGGGTACAAGAACAGGAATTGAAGTCTGAATTTGAGCAGAACCTGTCTGAGAAACTCTCTGAACAAGAATTACAATTTCGTCGTCTCAGTCAAGAGCAAGTTGACAACTTTACTCTGGATATAAATACTGCCTATGCCAGACTCAGAGGAATCGAACAGGCTGTTCAGAGCCATGCAGTTGCTGAAGAGGAAGCCAGAAAAGCCCACCAACTCTGGCTTTCAGTGGAGGCATTAAAGTACAGCATGAAGACCTCATCTGCAGAAACACCTACTATCCCGCTGGGTAGTGCGGTTGAGGCCATCAAAGCCAACTGTTCTGATAATGAATTCACCCAAGCTTTAACCGCAGCTATCCCTCCAGAGTCCCTGACCCGTGGGGTGTACAGTGAAGAGACCCTTAGAGCCCGTTTCTATGCTGTTCAAAAACTGGCCCGAAGGGTAGCAATGATTGATGAAACCAGAAATAGCTTGTACCAGTACTTCCTCTCCTACCTACAGTCCCTGCTCCTATTCCCACCTCAGCAACTGAAGCCGCCCCCAGAGCTCTGCCCTGAGGATATAAACACATTTAAATTACTGTCATATGCTTCCTATTGCATTGAGCATGGTGATCTGGAGCTAGCAGCAAAGTTTGTCAATCAGCTGAAGGGGGAATCCAGACGAGTGGCACAGGACTGGCTGAAGGAAGCCCGAATGACCCTAGAAACGAAACAGATAGTGGAAATCCTGACAGCATATGCCAGCGCCGTAGGAATAGGAACCACTCAGGTGCAGCCAGAGTGAATCCACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAATAATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGCTTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGAAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGAATTGGTTAATTGGTTGTAACACTGGCAGAGCATTACGCTGACTTGACGGGACGGCGCAAGCTCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT

Sequencing Information:

Phred Score: 861
Date: 2017-04-28

Last Passing Sequencing Read:

NNGGCCGCGCATAGATTTATTTTGATGATGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCACCATGCTGCGGGCCTGTCAGTTATCGGGTGTGACCGCCGCCGCCCAGAGTTGTCTCTGTGGGAAGTTTGTCCTCCGTCCATTGCGACCATGCCGCAGATACTCTACTTCAGGCAGCTCTGGGTTGACTACTGGCAAAATTGCTGGAGCTGGCCTTTTGTTTGTTGGTGGAGGTATTGGTGGCACTATCCTATATGCCAAATGGGATTCCCATTTCCGGGAAAGTGTAGAGAAAACCATACCTTACTCAGACAAACTCTTCGAGATGGTTCTTGGTCCTGCAGCTTATAATGTTCCATTGCCAAAGAAATCGATTCAGTCGGGTCCACTAAAAATCTCTAGTGTATCAGAAGTAATGAAAGAATCTAAACAGCCTGCCTCACAACTCCAAAAACAAAAGGGAGATACTCCAGCTTCAGCAACAGCACCTACAGAAGCGGCTCAAATTATTTCTGCAGCAGGTGATACCCTGTCGGTCCCAGCCCCTGCAGTTCAGCCTGAGGAATCTTTAAAAACTGATCACCCTGAAATTGGTGAAGGAAAACCCACACCTGCACTTTCAGAAGAAGCATCCTCATCTTCTATAAGGGAGCGACCACCTGAAGAAGTTGCAGCTCGCCTTGCACAACAGGAAAAACAAGAACAAGTTAAAATTGAGTCTCTAGCCAAGAGCTTAGAAGATGCTCTGAGGCAAACTGCAAGTGTCACTCTGCAGGCTATTGCAGCTCAGAATGCTGCGGTCCAGGCTGTNCATGCACACTCCAACATATTGAAAGCCGCCATGGACAATTCTGAGATTGCAGGCGAGAAGAAATCTGCTCAGTGGCGCACAGTGGAGGGTGCATTGAAGGAACGCAGAAAGGCAGTAGATGAAGCTGCCGATGCCCTTCTCAAAGCCNAAGAAGAAGTAGAGAAGATGAAAAGTGTGATTGAAAATGCAAAGAAAAAAGAAGTTGCTGGGGCCCAGCCTCATATAACTGCTGCAGAGGGTAAACTTCACACATGATAGTTGATCTGGATAATGTGGCAAAAAGTTCCAGCAGCTCGTCTGAAGCTAAGGTGNATCTCANTTCATGAGCTGGTGGTCCAGCCCGGGATGACTTTACCGAGACTGAACGTATTACTCCGAACTCTTCCTGGTGAAAGGATGANGGTTCTGAACTACTGACAACTTCCACGAAGAACTGAATCCTCATGTTCAGGCCACGCCNATTGACCCGAAAAAAAGTGTGAAAAAAGCCTCCAAAACCCTTCCCTTCCCTTGAAAAAAATTGAAAAAAGGTTTTTTCTTTAAAAAC

Vector Information:

Vector Name:pDONR221
Type:bacterial plasmid
Description:Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Properties:Gateway, donor (entry), recombinational cloning
Comments:The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Map:pdonr221_pdonrzeo_map.pdf
Sequence:pDONR221_FASTA.txt
Size (bp):4762
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 50ug/mL kanamycin Growth with the single antibiotic in LB at 37 degrees is recommended. Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.

Authors:

Author Name Author Type
The ORFeome Collaboration Consortium