Clone: HsCD00295178

Clone ID:HsCD00295178
Is Verified:Y
Status:AVAILABLE
Source:The ORFeome Collaboration
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

Original Clone ID FLH481433.01X
IMAGE ID 100063951
GI 182887776
HIP Clone ID 481433
GenBank Accession BC160015
HIP Master Clone ID 399161

Property:

Collection: NIH_MGC_435
Collection: OCAB20
Collection: The ORFeome Collaboration

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 2739 Homo sapiens CLOSED 5587 PRKD1 protein kinase D1
Insert1
Size (bp)2739
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 5587
Gene SymbolPRKD1
Gene Nameprotein kinase D1
Keyword

Insert Sequence:

GTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGAGCGCCCCTCCGGTCCTGCGGCCGCCCAGTCCGCTGCTGCCCGTGGCGGCGGCAGCTGCCGCAGCGGCCGCCGCACTGGTCCCAGGGTCCGGGCCCGGGCCCGCGCCGTTCTTGGCTCCTGTCGCGGCCCCGGTCGGGGGCATCTCGTTCCATCTGCAGATCGGCCTGAGCCGTGAGCCGGTGCTGCTGCTGCAGGACTCGTCCGGGGACTACAGCCTGGCGCACGTCCGCGAGATGGCTTGCTCCATTGTCGACCAGAAGTTCCCTGAATGTGGTTTCTACGGAATGTATGATAAGATCCTGCTTTTTCGCCATGACCCTACCTCTGAAAACATCCTTCAGCTGGTGAAAGCGGCCAGTGATATCCAGGAAGGCGATCTTATTGAAGTGGTCTTGTCAGCTTCCGCCACCTTTGAAGACTTTCAGATTCGTCCCCACGCTCTCTTTGTTCATTCATACAGAGCTCCAGCTTTCTGTGATCACTGTGGAGAAATGCTGTGGGGGCTGGTACGTCAAGGTCTTAAATGTGAAGGGTGTGGTCTGAATTACCATAAGAGATGTGCATTTAAAATACCCAACAATTGCAGCGGTGTGAGGCGGAGAAGGCTCTCAAACGTTTCCCTCACTGGGGTCAGCACCATCCGCACATCATCTGCTGAACTCTCTACAAGTGCCCCTGATGAGCCCCTTCTGCAAAAATCACCATCAGAGTCGTTTATTGGTCGAGAGAAGAGGTCAAATTCTCAATCATACATTGGACGACCAATTCACCTTGACAAGATTTTGATGTCTAAAGTTAAAGTGCCGCACACATTTGTCATCCACTCCTACACCCGGCCCACAGTGTGCCAGTACTGCAAGAAGCTTCTGAAGGGGCTTTTCAGGCAGGGCTTGCAGTGCAAAGATTGCAGATTCAACTGCCATAAACGTTGTGCACCGAAAGTACCAAACAACTGCCTTGGCGAAGTGACCATTAATGGAGATTTGCTTAGCCCTGGGGCAGAGTCTGATGTGGTCATGGAAGAAGGGAGTGATGACAATGATAGTGAAAGGAACAGTGGGCTCATGGATGATATGGAAGAAGCAATGGTCCAAGATGCAGAGATGGCAATGGCAGAGTGCCAGAACGACAGTGGCGAGATGCAAGATCCAGACCCAGACCACGAGGACGCCAACAGAACCATCAGTCCATCAACAAGCAACAATATCCCACTCATGAGGGTAGTGCAGTCTGTCAAACACACGAAGAGGAAAAGCAGCACAGTCATGAAAGAAGGATGGATGGTCCACTACACCAGCAAGGACACGCTGCGGAAACGGCACTATTGGAGATTGGATAGCAAATGTATTACCCTCTTTCAGAATGACACAGGAAGCAGGTACTACAAGGAAATTCCTTTATCTGAAATTTTGTCTCTGGAACCAGTAAAAACTTCAGCTTTAATTCCTAATGGGGCCAATCCTCATTGTTTCGAAATCACTACGGCAAATGTAGTGTATTATGTGGGAGAAAATGTGGTCAATCCTTCCAGCCCATCACCAAATAACAGTGTTCTCACCAGTGGCGTTGGTGCAGATGTGGCCAGGATGTGGGAGATAGCCATCCAGCATGCCCTTATGCCCGTCATTCCCAAGGGCTCCTCCGTGGGTACAGGAACCAACTTGCACAGAGATATCTCTGTGAGTATTTCAGTATCAAATTGCCAGATTCAAGAAAATGTGGACATCAGCACAGTATATCAGATTTTTCCTGATGAAGTACTGGGTTCTGGACAGTTTGGAATTGTTTATGGAGGAAAACATCGTAAAACAGGAAGAGATGTAGCTATTAAAATCATTGACAAATTACGATTTCCAACAAAACAAGAAAGCCAGCTTCGTAATGAGGTTGCAATTCTACAGAACCTTCATCACCCTGGTGTTGTAAATTTGGAGTGTATGTTTGAGACGCCTGAAAGAGTGTTTGTTGTTATGGAAAAACTCCATGGAGACATGCTGGAAATGATCTTGTCAAGTGAAAAGGGCAGGTTGCCAGAGCACATAACGAAGTTTTTAATTACTCAGATACTCGTGGCTTTGCGGCACCTTCATTTTAAAAATATCGTTCACTGTGACCTCAAACCAGAAAATGTGTTGCTAGCCTCAGCTGATCCTTTTCCTCAGGTGAAACTTTGTGATTTTGGTTTTGCCCGGATCATTGGAGAGAAGTCTTTCCGGAGGTCAGTGGTGGGTACCCCCGCTTACCTGGCTCCTGAGGTCCTAAGGAACAAGGGCTACAATCGCTCTCTAGACATGTGGTCTGTTGGGGTCATCATCTATGTAAGCCTAAGCGGCACATTCCCATTTAATGAAGATGAAGACATACACGACCAAATTCAGAATGCAGCTTTCATGTATCCACCAAATCCCTGGAAGGAAATATCTCATGAAGCCATTGATCTTATCAACAATTTGCTGCAAGTAAAAATGAGAAAGCGCTACAGTGTGGATAAGACCTTGAGCCACCCTTGGCTACAGGACTATCAGACCTGGTTAGATTTGCGAGAGCTGGAATGCAAAATCGGGGAGCGCTACATCACCCATGAAAGTGATGACCTGAGGTGGGAGAAGTATGCAGGCGAGCAGGGGCTGCAGTACCCCACACACCTGATCAATCCAAGTGCTAGCCACAGTGACACTCCTGAGACTGAAGAAACAGAAATGAAAGCCCTCGGTGAGCGTGTCAGCATCCTCTAGGGCCTCATGGGCCCAGCTTTCTTGTAC

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 2920
Start on reference sequence 182

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGAGCGCCCCTCCGGTCCTGCGGCCGCCCAGTCCGCTGCTGCCCGTGGCGGCGGCAGCTGCCGCAGCGGCCGCCGCACTGGTCCCAGGGTCCGGGCCCGGGCCCGCGCCGTTCTTGGCTCCTGTCGCGGCCCCGGTCGGGGGCATCTCGTTCCATCTGCAGATCGGCCTGAGCCGTGAGCCGGTGCTGCTGCTGCAGGACTCGTCCGGGGACTACAGCCTGGCGCACGTCCGCGAGATGGCTTGCTCCATTGTCGACCAGAAGTTCCCTGAATGTGGTTTCTACGGAATGTATGATAAGATCCTGCTTTTTCGCCATGACCCTACCTCTGAAAACATCCTTCAGCTGGTGAAAGCGGCCAGTGATATCCAGGAAGGCGATCTTATTGAAGTGGTCTTGTCAGCTTCCGCCACCTTTGAAGACTTTCAGATTCGTCCCCACGCTCTCTTTGTTCATTCATACAGAGCTCCAGCTTTCTGTGATCACTGTGGAGAAATGCTGTGGGGGCTGGTACGTCAAGGTCTTAAATGTGAAGGGTGTGGTCTGAATTACCATAAGAGATGTGCATTTAAAATACCCAACAATTGCAGCGGTGTGAGGCGGAGAAGGCTCTCAAACGTTTCCCTCACTGGGGTCAGCACCATCCGCACATCATCTGCTGAACTCTCTACAAGTGCCCCTGATGAGCCCCTTCTGCAAAAATCACCATCAGAGTCGTTTATTGGTCGAGAGAAGAGGTCAAATTCTCAATCATACATTGGACGACCAATTCACCTTGACAAGATTTTGATGTCTAAAGTTAAAGTGCCGCACACATTTGTCATCCACTCCTACACCCGGCCCACAGTGTGCCAGTACTGCAAGAAGCTTCTGAAGGGGCTTTTCAGGCAGGGCTTGCAGTGCAAAGATTGCAGATTCAACTGCCATAAACGTTGTGCACCGAAAGTACCAAACAACTGCCTTGGCGAAGTGACCATTAATGGAGATTTGCTTAGCCCTGGGGCAGAGTCTGATGTGGTCATGGAAGAAGGGAGTGATGACAATGATAGTGAAAGGAACAGTGGGCTCATGGATGATATGGAAGAAGCAATGGTCCAAGATGCAGAGATGGCAATGGCAGAGTGCCAGAACGACAGTGGCGAGATGCAAGATCCAGACCCAGACCACGAGGACGCCAACAGAACCATCAGTCCATCAACAAGCAACAATATCCCACTCATGAGGGTAGTGCAGTCTGTCAAACACACGAAGAGGAAAAGCAGCACAGTCATGAAAGAAGGATGGATGGTCCACTACACCAGCAAGGACACGCTGCGGAAACGGCACTATTGGAGATTGGATAGCAAATGTATTACCCTCTTTCAGAATGACACAGGAAGCAGGTACTACAAGGAAATTCCTTTATCTGAAATTTTGTCTCTGGAACCAGTAAAAACTTCAGCTTTAATTCCTAATGGGGCCAATCCTCATTGTTTCGAAATCACTACGGCAAATGTAGTGTATTATGTGGGAGAAAATGTGGTCAATCCTTCCAGCCCATCACCAAATAACAGTGTTCTCACCAGTGGCGTTGGTGCAGATGTGGCCAGGATGTGGGAGATAGCCATCCAGCATGCCCTTATGCCCGTCATTCCCAAGGGCTCCTCCGTGGGTACAGGAACCAACTTGCACAGAGATATCTCTGTGAGTATTTCAGTATCAAATTGCCAGATTCAAGAAAATGTGGACATCAGCACAGTATATCAGATTTTTCCTGATGAAGTACTGGGTTCTGGACAGTTTGGAATTGTTTATGGAGGAAAACATCGTAAAACAGGAAGAGATGTAGCTATTAAAATCATTGACAAATTACGATTTCCAACAAAACAAGAAAGCCAGCTTCGTAATGAGGTTGCAATTCTACAGAACCTTCATCACCCTGGTGTTGTAAATTTGGAGTGTATGTTTGAGACGCCTGAAAGAGTGTTTGTTGTTATGGAAAAACTCCATGGAGACATGCTGGAAATGATCTTGTCAAGTGAAAAGGGCAGGTTGCCAGAGCACATAACGAAGTTTTTAATTACTCAGATACTCGTGGCTTTGCGGCACCTTCATTTTAAAAATATCGTTCACTGTGACCTCAAACCAGAAAATGTGTTGCTAGCCTCAGCTGATCCTTTTCCTCAGGTGAAACTTTGTGATTTTGGTTTTGCCCGGATCATTGGAGAGAAGTCTTTCCGGAGGTCAGTGGTGGGTACCCCCGCTTACCTGGCTCCTGAGGTCCTAAGGAACAAGGGCTACAATCGCTCTCTAGACATGTGGTCTGTTGGGGTCATCATCTATGTAAGCCTAAGCGGCACATTCCCATTTAATGAAGATGAAGACATACACGACCAAATTCAGAATGCAGCTTTCATGTATCCACCAAATCCCTGGAAGGAAATATCTCATGAAGCCATTGATCTTATCAACAATTTGCTGCAAGTAAAAATGAGAAAGCGCTACAGTGTGGATAAGACCTTGAGCCACCCTTGGCTACAGGACTATCAGACCTGGTTAGATTTGCGAGAGCTGGAATGCAAAATCGGGGAGCGCTACATCACCCATGAAAGTGATGACCTGAGGTGGGAGAAGTATGCAGGCGAGCAGGGGCTGCAGTACCCCACACACCTGATCAATCCAAGTGCTAGCCACAGTGACACTCCTGAGACTGAAGAAACAGAAATGAAAGCCCTCGGTGAGCGTGTCAGCATCCTCTAGGGCCTCATGGGCCCAGCTTTCTTGTACTACAAAGTTGGCATTATAAAAAATAATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGCCTCCTCTAGACCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTGCCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAACCCTCGAGCCACCCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCG

Sequencing Information:

Phred Score: 920
Date: 2017-01-13

Last Passing Sequencing Read:

>26558-42_HsCD00295178-M13F_B6 920 1497 43 979 NNNCCGGCCCCNNNNNCCGCATAGATTTATTTTGATGAAGTGACCTGTTC GTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACA AAAAAGCAGAAGGGCCGTCAAGGCCCACCATGAGCGCCCCTCCGGTCCTG CGGCCGCCCAGTCCGCTGCTGCCCGTGGCGGCGGCAGCTGCCGCAGCGGC CGCCGCACTGGTCCCAGGGTCCGGGCCCGGGCCCGCGCCGTTCTTGGCTC CTGTCGCGGCCCCGGTCGGGGGCATCTCGTTCCATCTGCAGATCGGCCTG AGCCGTGAGCCGGTGCTGCTGCTGCAGGACTCGTCCGGGGACTACAGCCT GGCGCACGTCCGCGAGATGGCTTGCTCCATTGTCGACCAGAAGTTCCCTG AATGTGGTTTCTACGGAATGTATGATAAGATCCTGCTTTTTCGCCATGAC CCTACCTCTGAAAACATCCTTCAGCTGGTGAAAGCGGCCAGTGATATCCA GGAAGGCGATCTTATTGAAGTGGTCTTGTCAGCTTCCGCCACCTTTGAAG ACTTTCAGATTCGTCCCCACGCTCTCTTTGTTCATTCATACAGAGCTCCA GCTTTCTGTGATCACTGTGGAGAAATGCTGTGGGGGCTGGTACGTCAAGG TCTTAAATGTGAAGGGTGTGGTCTGAATTACCATAAGAGATGTGCATTTA AAATACCCAACAATTGCAGCGGTGTGAGGCGGAGAAGGCTCTCAAACGTT TCCCTCACTGGGGTCAGCACCATCCGCACATCATCTGCTGAACTCTCTAC AAGTGCCCCTGATGAGCCCCTTCTGCAAAAATCACCATCAGAGTCGTTTA TTGGTCGAGAGAAGAGGTCAAATTCTCAATCATACATTGGACGACCAATT CACCTTGACAAGATTTTGATGTCTAAAGTTAAAGTGCCGCACACATTTGT CATCCACTCCTACACCCGGCCCACAGTGTGCCAGTACTGCAAGAAGCTTC TGAAGGGGCTTTTCANGCAGGNCTTTGCAGTGCAAGATTGCAGATTCACT GCCATAANNCGTGTGCACGAAAGTACCNAACACTGCCTTGNCGAAGTGAC ATTATGNAGATTGCTTACCCTGGGGCAAATCTGATGTGTCTGGAGAAGGG ATGATGACATGATATGAAAGGACGTGGGCTCTGGATGATTGAAAAGNCAT GTCCAAATGCAAATGGCATGGCAATGCCAACNACGTGCCGATTGCAATCC AACCAACCNAGGAGCCACAGAACTTTTCCTACAGAAAATTTCTCTTGAGG GGGGCCCTCTACACCAAGAAGACCCTCTAAAAAAGGTGTGCTTCCCAGAC CGCGGACCCTTGGAGTGAAAAGTTCCTTTTATAAGAGGGCGGAACTTTAA TTTTGGGAAAAATTTTGGCCCCTTCTCCCCGGGGGAGGAAGGACCAACCC

Vector Information:

Vector Name:pENTR223.1
Type:bacterial plasmid
Description:Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Properties:Gateway, donor (entry), recombinational cloning
Comments:Additional information about this vector is available from the commercial website and at the ORFeome website http://www.orfeomecollaboration.org/html/vectors.shtml.
Map:pENTR223-1-map.doc
Sequence:pENTR223_1.txt
Size (bp):4311
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial spectinomycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL spectinomycin Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.

Authors:

Author Name Author Type
The ORFeome Collaboration Consortium