Clone: HsCD00294960

Clone ID:HsCD00294960
Is Verified:Y
Status:AVAILABLE
Source:The ORFeome Collaboration
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

Original Clone ID FLH481215.01X
GI 187252584
IMAGE ID 100066421
HIP Master Clone ID 398943
GenBank Accession BC166695
HIP Clone ID 481215

Property:

Collection: NIH_MGC_435
Collection: OCAB22
Collection: The ORFeome Collaboration

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 2463 Homo sapiens CLOSED 11086 ADAM29 ADAM metallopeptidase domain 29
Insert1
Size (bp)2463
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 11086
Gene SymbolADAM29
Gene NameADAM metallopeptidase domain 29
Keyword

Insert Sequence:

GTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGAAGATGTTACTCCTGCTGCATTGCCTTGGGGTGTTTCTGTCCTGTTCTGGACACATCCAGGATGAGCACCCCCAATATCACAGCCCTCCGGATGTGGTGATTCCTGTGAGGATAACTGGCACCACCAGAGGCATGACACCTCCAGGCTGGCTCTCCTATATCCTGCCCTTTGGAGGCCAGAAACACATTATCCACATAAAGGTCAAGAAGCTTTTGTTTTCCAAACACCTCCCTGTGTTCACCTACACAGACCAGGGTGCTATCCTTGAGGACCAGCCATTTGTCCAGAATAACTGCTACTATCATGGTTATGTGGAAGGGGACCCAGAATCCCTGGTTTCCCTCAGTACCTGTTTTGGGGGTTTTCAAGGAATATTACAGATAAATGACTTTGCTTATGAAATCAAGCCCCTAGCATTTTCTACCACGTTTGAACATCTGGTATACAAGATGGACAGTGAGGAGAAACAATTTTCAACCATGAGATCCGGATTTATGCAAAATGAAATAACATGCCGAATGGAATTTGAAGAAATTGATAATTCCACTCAGAAGCAAAGTTCTTATGTGGGCTGGTGGATCCATTTTAGGATTGTTGAAATTGTAGTCGTCATTGATAATTATCTGTACATTCGTTATGAAAGGAACGACTCAAAGTTGCTGGAGGATCTATATGTTATTGTTAATATAGTGGATTCCATTTTGGATGTCATTGGTGTTAAGGTGTTATTATTTGGTTTGGAGATCTGGACCAATAAAAACCTCATTGTAGTAGATGATGTAAGGAAATCTGTGCACCTGTATTGCAAGTGGAAGTCGGAGAACATTACGCCCCGGATGCAACATGACACCTCACATCTTTTCACAACTCTAGGATTAAGAGGGTTAAGTGGCATAGGAGCTTTTAGAGGAATGTGTACACCACACCGTAGTTGTGCAATTGTTACTTTCATGAACAAAACTTTGGGCACTTTTTCAATTGCAGTGGCTCATCATCTAGGTCATAATTTGGGCATGAACCATGATGAGGATACATGTCGTTGTTCACAACCTAGATGCATAATGCATGAAGGCAACCCACCAATAACTAAATTTAGCAATTGTAGTTATGGTGATTTTTGGGAATATACTGTAGAGAGGACAAAGTGTTTGCTTGAAACAGTACACACAAAGGACATCTTTAATGTGAAGCGCTGTGGGAATGGTGTTGTTGAAGAAGGAGAAGAGTGTGACTGTGGACCTTTAAAGCATTGTGCAAAAGATCCCTGCTGTCTGTCAAATTGCACTCTGACTGATGGTTCTACTTGTGCTTTTGGGCTTTGTTGCAAAGACTGCAAGTTCCTACCATCAGGGAAAGTGTGTAGAAAGGAGGTCAATGAATGTGATCTTCCAGAGTGGTGCAATGGTACTTCCCATAAGTGCCCAGATGACTTTTATGTGGAAGATGGAATTCCCTGTAAGGAGAGGGGCTACTGCTATGAAAAGAGCTGTCATGACCGCAATGAACAGTGTAGGAGGATTTTTGGTGCAGGCGCAAATACTGCAAGTGAGACTTGCTACAAAGAATTGAACACCTTAGGTGACCGTGTTGGTCACTGTGGTATCAAAAATGCTACATATATAAAGTGTAATATCTCAGATGTCCAGTGTGGAAGAATTCAGTGTGAGAATGTGACAGAAATTCCCAATATGAGTGATCATACTACTGTGCATTGGGCTCGCTTCAATGACATAATGTGCTGGAGTACTGATTACCATTTGGGGATGAAGGGACCTGATATTGGTGAAGTGAAAGATGGAACAGAGTGTGGGATAGATCATATATGCATCCACAGGCACTGTGTCCATATAACCATCTTGAATAGTAATTGCTCACCTGCATTTTGTAACAAGAGGGGCATCTGCAACAATAAACATCACTGCCATTGCAATTATCTGTGGGACCCTCCCAACTGCCTGATAAAAGGCTATGGAGGTAGTGTTGACAGTGGCCCACCCCCTAAGAGAAAGAAGAAAAAGAAGTTCTGTTATCTGTGTATATTGTTGCTTATTGTTTTGTTTATTTTATTATGTTGTCTTTATCGACTTTGTAAAAAAAGTAAACCAATAAAAAAGCAGCAAGATGTTCAAACTCCATCTGCAAAAGAAGAGGAAAAAATTCAGCGTCGACCTCATGAGTTACCTCCCCAGAGTCAACCTTGGGTGATGCCTTCCCAGAGTCAACCTCCTGTGACGCCTTCCCAGAGTCATCCTCAGGTGATGCCTTCCCAGAGTCAACCTCCTGTGACACCCTCCCAGAGTCAACCTCGGGTGATGCCTTCTCAGAGTCAACCTCCTGTGATGCCTTCCCAGAGTCATCCTCAGTTGACGCCTTCCCAGAGTCAACCTCCTGTGACACCCTCCCAGAGGCAACCTCAGTTGATGCCTTCCCAGAGTCAACCTCCTGTGACGCCCTCCTAGGGCCTCATGGGCCCAGCTTTCTTGTAC

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 3085
Start on reference sequence 623

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGAAGATGTTACTCCTGCTGCATTGCCTTGGGGTGTTTCTGTCCTGTTCTGGACACATCCAGGATGAGCACCCCCAATATCACAGCCCTCCGGATGTGGTGATTCCTGTGAGGATAACTGGCACCACCAGAGGCATGACACCTCCAGGCTGGCTCTCCTATATCCTGCCCTTTGGAGGCCAGAAACACATTATCCACATAAAGGTCAAGAAGCTTTTGTTTTCCAAACACCTCCCTGTGTTCACCTACACAGACCAGGGTGCTATCCTTGAGGACCAGCCATTTGTCCAGAATAACTGCTACTATCATGGTTATGTGGAAGGGGACCCAGAATCCCTGGTTTCCCTCAGTACCTGTTTTGGGGGTTTTCAAGGAATATTACAGATAAATGACTTTGCTTATGAAATCAAGCCCCTAGCATTTTCTACCACGTTTGAACATCTGGTATACAAGATGGACAGTGAGGAGAAACAATTTTCAACCATGAGATCCGGATTTATGCAAAATGAAATAACATGCCGAATGGAATTTGAAGAAATTGATAATTCCACTCAGAAGCAAAGTTCTTATGTGGGCTGGTGGATCCATTTTAGGATTGTTGAAATTGTAGTCGTCATTGATAATTATCTGTACATTCGTTATGAAAGGAACGACTCAAAGTTGCTGGAGGATCTATATGTTATTGTTAATATAGTGGATTCCATTTTGGATGTCATTGGTGTTAAGGTGTTATTATTTGGTTTGGAGATCTGGACCAATAAAAACCTCATTGTAGTAGATGATGTAAGGAAATCTGTGCACCTGTATTGCAAGTGGAAGTCGGAGAACATTACGCCCCGGATGCAACATGACACCTCACATCTTTTCACAACTCTAGGATTAAGAGGGTTAAGTGGCATAGGAGCTTTTAGAGGAATGTGTACACCACACCGTAGTTGTGCAATTGTTACTTTCATGAACAAAACTTTGGGCACTTTTTCAATTGCAGTGGCTCATCATCTAGGTCATAATTTGGGCATGAACCATGATGAGGATACATGTCGTTGTTCACAACCTAGATGCATAATGCATGAAGGCAACCCACCAATAACTAAATTTAGCAATTGTAGTTATGGTGATTTTTGGGAATATACTGTAGAGAGGACAAAGTGTTTGCTTGAAACAGTACACACAAAGGACATCTTTAATGTGAAGCGCTGTGGGAATGGTGTTGTTGAAGAAGGAGAAGAGTGTGACTGTGGACCTTTAAAGCATTGTGCAAAAGATCCCTGCTGTCTGTCAAATTGCACTCTGACTGATGGTTCTACTTGTGCTTTTGGGCTTTGTTGCAAAGACTGCAAGTTCCTACCATCAGGGAAAGTGTGTAGAAAGGAGGTCAATGAATGTGATCTTCCAGAGTGGTGCAATGGTACTTCCCATAAGTGCCCAGATGACTTTTATGTGGAAGATGGAATTCCCTGTAAGGAGAGGGGCTACTGCTATGAAAAGAGCTGTCATGACCGCAATGAACAGTGTAGGAGGATTTTTGGTGCAGGCGCAAATACTGCAAGTGAGACTTGCTACAAAGAATTGAACACCTTAGGTGACCGTGTTGGTCACTGTGGTATCAAAAATGCTACATATATAAAGTGTAATATCTCAGATGTCCAGTGTGGAAGAATTCAGTGTGAGAATGTGACAGAAATTCCCAATATGAGTGATCATACTACTGTGCATTGGGCTCGCTTCAATGACATAATGTGCTGGAGTACTGATTACCATTTGGGGATGAAGGGACCTGATATTGGTGAAGTGAAAGATGGAACAGAGTGTGGGATAGATCATATATGCATCCACAGGCACTGTGTCCATATAACCATCTTGAATAGTAATTGCTCACCTGCATTTTGTAACAAGAGGGGCATCTGCAACAATAAACATCACTGCCATTGCAATTATCTGTGGGACCCTCCCAACTGCCTGATAAAAGGCTATGGAGGTAGTGTTGACAGTGGCCCACCCCCTAAGAGAAAGAAGAAAAAGAAGTTCTGTTATCTGTGTATATTGTTGCTTATTGTTTTGTTTATTTTATTATGTTGTCTTTATCGACTTTGTAAAAAAAGTAAACCAATAAAAAAGCAGCAAGATGTTCAAACTCCATCTGCAAAAGAAGAGGAAAAAATTCAGCGTCGACCTCATGAGTTACCTCCCCAGAGTCAACCTTGGGTGATGCCTTCCCAGAGTCAACCTCCTGTGACGCCTTCCCAGAGTCATCCTCAGGTGATGCCTTCCCAGAGTCAACCTCCTGTGACACCCTCCCAGAGTCAACCTCGGGTGATGCCTTCTCAGAGTCAACCTCCTGTGATGCCTTCCCAGAGTCATCCTCAGTTGACGCCTTCCCAGAGTCAACCTCCTGTGACACCCTCCCAGAGGCAACCTCAGTTGATGCCTTCCCAGAGTCAACCTCCTGTGACGCCCTCCTAGGGCCTCATGGGCCCAGCTTTCTTGTACTACAAAGTTGGCATTATAAAAAATAATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGCCTCCTCTAGACCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTGCCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAACCCTCGAGCCACCCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCG

Vector Information:

Vector Name:pENTR223.1
Type:bacterial plasmid
Description:Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Properties:Gateway, donor (entry), recombinational cloning
Comments:Additional information about this vector is available from the commercial website and at the ORFeome website http://www.orfeomecollaboration.org/html/vectors.shtml.
Map:pENTR223-1-map.doc
Sequence:pENTR223_1.txt
Size (bp):4311
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial spectinomycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL spectinomycin Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.

Authors:

Author Name Author Type
The ORFeome Collaboration Consortium