Clone: HsCD00294922

Clone ID:HsCD00294922
Is Verified:Y
Status:AVAILABLE
Source:The ORFeome Collaboration
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

IMAGE ID 100066383
Original Clone ID FLH481177.01X
HIP Clone ID 481177
HIP Master Clone ID 398905
GenBank Accession BC166657
GI 187252622

Property:

Collection: NIH_MGC_435
Collection: OCAB22
Collection: The ORFeome Collaboration

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 2334 Homo sapiens CLOSED 54893 MTMR10 myotubularin related protein 10
Insert1
Size (bp)2334
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 54893
Gene SymbolMTMR10
Gene Namemyotubularin related protein 10
Keyword

Insert Sequence:

GTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGTTCTCCCTCAAGCCGCCCAAACCCACCTTCAGGTCCTACCTCCTGCCACCGCCCCAGACTGACGATAAGATCAATTCGGAACCGAAGATTAAAAAACTGGAGCCAGTCCTTTTGCCAGGAGAAATTGTCGTAAATGAAGTCAATTTTGTGAGAAAATGCATTGCAACAGACACAAGCCAGTACGATTTGTGGGGAAAGCTGATATGCAGTAACTTCAAAATCTCCTTTATTACAGATGACCCAATGCCATTACAGAAATTCCATTACAGAAACCTTCTTCTTGGTGAACACGATGTCCCTTTAACATGTATTGAGCAAATTGTCACAGTAAACGACCACAAGAGGAAGCAGAAAGTCCTAGGCCCCAACCAGAAACTGAAATTTAATCCAACAGAGTTAATTATTTATTGTAAAGATTTCAGAATTGTCAGATTTCGCTTTGATGAATCAGGTCCCGAAAGTGCTAAAAAGGTATGCCTTGCAATAGCTCATTATTCCCAGCCAACAGACCTCCAGCTACTCTTTGCATTTGAATATGTTGGGAAAAAATACCACAATTCAGCAAACAAAATTAATGGAATTCCCTCAGGAGATGGAGGAGGAGGAGGAGGAGGAGGTAATGGAGCTGGTGGTGGCAGCAGCCAGAAAACTCCACTCTTTGAAACTTACTCGGATTGGGACAGAGAAATCAAGAGGACAGGTGCTTCCGGGTGGAGAGTTTGTTCTATTAACGAGGGTTACATGATATCCACTTGCCTTCCAGAATACATTGTAGTGCCAAGTTCTTTAGCAGACCAAGATCTAAAGATCTTTTCCCATTCTTTTGTTGGGAGAAGGATGCCACTCTGGTGCTGGAGCCACTCTAACGGCAGTGCTCTTGTGCGAATGGCCCTCATCAAAGACGTGCTGCAGCAGAGGAAGATTGACCAGAGGATTTGTAATGCAATAACTAAAAGTCACCCACAGAGAAGTGATGTTTACAAATCAGATTTGGATAAGACCTTGCCTAATATTCAAGAAGTACAGGCAGCATTTGTAAAACTGAAGCAGCTATGCGTTAATGAGCCTTTTGAAGAAACTGAAGAGAAATGGTTATCTTCACTGGAAAATACTCGATGGTTAGAATATGTAAGGGCATTCCTTAAGCATTCAGCAGAACTTGTATACATGCTAGAAAGCAAACATCTCTCTGTAGTCCTACAAGAGGAGGAAGGAAGAGACTTGAGCTGTTGTGTAGCTTCTCTTGTTCAAGTGATGCTGGATCCCTATTTTAGGACAATTACTGGATTTCAGAGTCTGATACAGAAGGAGTGGGTCATGGCAGGATATCAGTTTCTAGACAGATGCAACCATCTAAAGAGATCAGAGAAAGAGTCTCCTTTATTTTTGCTATTCTTGGATGCCACCTGGCAGCTGTTAGAACAATATCCTGCAGCTTTTGAGTTCTCCGAAACCTACCTGGCAGTGTTGTATGACAGCACCCGGATCTCACTGTTTGGCACCTTCCTGTTCAACTCCCCTCACCAGCGAGTGAAGCAAAGCACGGAATTTGCTATAAGCAAAAACATCCAATTGGGTGATGAGAAGGGCTTAAAATTCCCCTCTGTTTGGGACTGGTCTCTCCAGTTTACAGCAAAGGATCGCACCCTTTTCCATAACCCCTTCTACATTGGAAAGAGCACACCTTGTATACAGAATGGCTCCGTGAAGTCTTTTAAACGGACAAAGAAAAGCTACAGCTCCACACTAAGAGGAATGCCGTCTGCCTTAAAGAATGGAATCATCAGTGACCAAGAATTACTTCCAAGGAGAAATTCATTGATATTAAAACCAAAGCCAGATCCAGCTCAGCAAACCGACAGCCAGAACAGTGATACGGAGCAGTATTTTAGAGAATGGTTTTCCAAACCCGCCAACCTGCACGGTGTTATTCTGCCACGTGTCTCTGGAACACACATAAAACTGTGGAAACTGTGCTACTTCCGCTGGGTTCCCGAGGCCCAGATCAGCCTGGGTGGCTCCATCACAGCCTTTCACAAGCTCTCCCTCCTGGCTGATGAAGTCGACGTACTGAGCAGGATGCTGCGGCAACAGCGCAGTGGCCCCCTGGAGGCCTGCTATGGGGAGCTGGGCCAGAGCAGGATGTACTTCAACGCCAGCGGCCCTCACCACACCGACACCTCGGGGACACCGGAGTTTCTCTCCTCCTCATTTCCATTTTCTCCTGTAGGGAATCTGTGCAGACGAAGCATTTTAGGAACACCATTAAGCAAATTTTTAAGTGGGGCCAAAATATGGTTGTCTACTGAGACATTAGCAAATGAAGACTAGGGCCTCATGGGCCCAGCTTTCTTGTAC

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 2432
Start on reference sequence 99

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGTTCTCCCTCAAGCCGCCCAAACCCACCTTCAGGTCCTACCTCCTGCCACCGCCCCAGACTGACGATAAGATCAATTCGGAACCGAAGATTAAAAAACTGGAGCCAGTCCTTTTGCCAGGAGAAATTGTCGTAAATGAAGTCAATTTTGTGAGAAAATGCATTGCAACAGACACAAGCCAGTACGATTTGTGGGGAAAGCTGATATGCAGTAACTTCAAAATCTCCTTTATTACAGATGACCCAATGCCATTACAGAAATTCCATTACAGAAACCTTCTTCTTGGTGAACACGATGTCCCTTTAACATGTATTGAGCAAATTGTCACAGTAAACGACCACAAGAGGAAGCAGAAAGTCCTAGGCCCCAACCAGAAACTGAAATTTAATCCAACAGAGTTAATTATTTATTGTAAAGATTTCAGAATTGTCAGATTTCGCTTTGATGAATCAGGTCCCGAAAGTGCTAAAAAGGTATGCCTTGCAATAGCTCATTATTCCCAGCCAACAGACCTCCAGCTACTCTTTGCATTTGAATATGTTGGGAAAAAATACCACAATTCAGCAAACAAAATTAATGGAATTCCCTCAGGAGATGGAGGAGGAGGAGGAGGAGGAGGTAATGGAGCTGGTGGTGGCAGCAGCCAGAAAACTCCACTCTTTGAAACTTACTCGGATTGGGACAGAGAAATCAAGAGGACAGGTGCTTCCGGGTGGAGAGTTTGTTCTATTAACGAGGGTTACATGATATCCACTTGCCTTCCAGAATACATTGTAGTGCCAAGTTCTTTAGCAGACCAAGATCTAAAGATCTTTTCCCATTCTTTTGTTGGGAGAAGGATGCCACTCTGGTGCTGGAGCCACTCTAACGGCAGTGCTCTTGTGCGAATGGCCCTCATCAAAGACGTGCTGCAGCAGAGGAAGATTGACCAGAGGATTTGTAATGCAATAACTAAAAGTCACCCACAGAGAAGTGATGTTTACAAATCAGATTTGGATAAGACCTTGCCTAATATTCAAGAAGTACAGGCAGCATTTGTAAAACTGAAGCAGCTATGCGTTAATGAGCCTTTTGAAGAAACTGAAGAGAAATGGTTATCTTCACTGGAAAATACTCGATGGTTAGAATATGTAAGGGCATTCCTTAAGCATTCAGCAGAACTTGTATACATGCTAGAAAGCAAACATCTCTCTGTAGTCCTACAAGAGGAGGAAGGAAGAGACTTGAGCTGTTGTGTAGCTTCTCTTGTTCAAGTGATGCTGGATCCCTATTTTAGGACAATTACTGGATTTCAGAGTCTGATACAGAAGGAGTGGGTCATGGCAGGATATCAGTTTCTAGACAGATGCAACCATCTAAAGAGATCAGAGAAAGAGTCTCCTTTATTTTTGCTATTCTTGGATGCCACCTGGCAGCTGTTAGAACAATATCCTGCAGCTTTTGAGTTCTCCGAAACCTACCTGGCAGTGTTGTATGACAGCACCCGGATCTCACTGTTTGGCACCTTCCTGTTCAACTCCCCTCACCAGCGAGTGAAGCAAAGCACGGAATTTGCTATAAGCAAAAACATCCAATTGGGTGATGAGAAGGGCTTAAAATTCCCCTCTGTTTGGGACTGGTCTCTCCAGTTTACAGCAAAGGATCGCACCCTTTTCCATAACCCCTTCTACATTGGAAAGAGCACACCTTGTATACAGAATGGCTCCGTGAAGTCTTTTAAACGGACAAAGAAAAGCTACAGCTCCACACTAAGAGGAATGCCGTCTGCCTTAAAGAATGGAATCATCAGTGACCAAGAATTACTTCCAAGGAGAAATTCATTGATATTAAAACCAAAGCCAGATCCAGCTCAGCAAACCGACAGCCAGAACAGTGATACGGAGCAGTATTTTAGAGAATGGTTTTCCAAACCCGCCAACCTGCACGGTGTTATTCTGCCACGTGTCTCTGGAACACACATAAAACTGTGGAAACTGTGCTACTTCCGCTGGGTTCCCGAGGCCCAGATCAGCCTGGGTGGCTCCATCACAGCCTTTCACAAGCTCTCCCTCCTGGCTGATGAAGTCGACGTACTGAGCAGGATGCTGCGGCAACAGCGCAGTGGCCCCCTGGAGGCCTGCTATGGGGAGCTGGGCCAGAGCAGGATGTACTTCAACGCCAGCGGCCCTCACCACACCGACACCTCGGGGACACCGGAGTTTCTCTCCTCCTCATTTCCATTTTCTCCTGTAGGGAATCTGTGCAGACGAAGCATTTTAGGAACACCATTAAGCAAATTTTTAAGTGGGGCCAAAATATGGTTGTCTACTGAGACATTAGCAAATGAAGACTAGGGCCTCATGGGCCCAGCTTTCTTGTACTACAAAGTTGGCATTATAAAAAATAATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGCCTCCTCTAGACCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTGCCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAACCCTCGAGCCACCCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCG

Sequencing Information:

Phred Score: 0
Date: 2012-01-13

Last Passing Sequencing Read:

CATATGATTTTATTTTGACTGGATAGTGACCTGTTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGTTCTCCCTCAAGCCGCCCAAACCCACCTTCAGGTCCTACCTCCTGCCACCGCCCCAGACTGACGATAAGATCAATTCGGAACCGAAGATTAAAAAACTGGAGCCAGTCCTTTTGCCAGGAGAAATTGTCGTAAATGAAGTCAATTTTGTGAGAAAATGCATTGCAACAGACACAAGCCAGTACGATTTGTGGGGAAAGCTGATATGCAGTAACTTCAAAATCTCCTTTATTACAGATGACCCAATGCCATTACAGAAATTCCATTACAGAAACCTTCTTCTTGGTGAACACGATGTCCCTTTAACATGTATTGAGCAAATTGTCACAGTAAACGACCACAAGAGGAAGCAGAAAGTCCTAGGCCCCAACCAGAAACTGAAATTTAATCCAACAGAGTTAATTATTTATTGTAAAGATTTCAGAATTGTCAGATTTCGCTTTGATGAATCAGGTCCCGAAAGTGCTAAAAAGGTATGCCTTGCAATAGCTCATTATTCCCAGCCAACAGACCTCCAGCTACTCTTTGCATTTGAATATGTTGGGAAAAAATACCACAATTCAGCAAACAAAATTAATGGAATTCCCTCAGGAGATGGAGGAGGAGGAGGAGGAGGAGGTAATGGAGCTGGTGGTGGCAGCAGCCAGAAAACTCCACTCTTTGAAACTTACTCGGATTGGGACAGAGAAATCAAGAGGACAGGTGCTTCCGGGTGGAGAGTTTGTTCTATTAACGAGGGTTACATGATATCCACTTGCCTTCCAGAATACATTGTAGTGCCNAGTTCTTTAGCAGACCAAGATCTAAAGATCTTTTCCCATTCTTTTGTTGGGAGAAGGATGCCACTCTGGTGCTGGAGCCNCTCTAACGGCAGTGCTCTGGTGCGAATGGCCCTCATCAAAGACGTGCTGCACCANAGGAAAATGACCAGAGGATTTGTAATGCAATANCTAAAAGTCCCCCCAGAGANTGATGNTTCNAATCANATTNGANAANACTTGCNAAATTCAGAANNCNGGCCGCNTNGTAAACTGAACNCCTNGCGTTATGACCNTTNNAAAACNGAAAAAANGGTTTCTNCCNGGGAAANCCCCGGGGGTAAAATTNGNGGGGCTTCNTAACCTNCCCNAANNTTTTACTNGCTAAANAAACTNTNTTTTTTTCCNAAANGNAAGAAAANTGNGGGGGGNACNTCTTGNCGGGGGGGGCCCNTTTGGAAATCGGGTTTAAACCNAAAANGGGGGNGGGGGGAATTTTTNAANNNCCCNNAAAAAAAANNCCTTTTTTTG

Vector Information:

Vector Name:pENTR223.1
Type:bacterial plasmid
Description:Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Properties:Gateway, donor (entry), recombinational cloning
Comments:Additional information about this vector is available from the commercial website and at the ORFeome website http://www.orfeomecollaboration.org/html/vectors.shtml.
Map:pENTR223-1-map.doc
Sequence:pENTR223_1.txt
Size (bp):4311
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial spectinomycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL spectinomycin Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.

Authors:

Author Name Author Type
The ORFeome Collaboration Consortium