Clone: HsCD00294888

Clone ID:HsCD00294888
Is Verified:Y
Status:AVAILABLE
Source:The ORFeome Collaboration
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

Original Clone ID FLH481143.01X
IMAGE ID 100066349
GenBank Accession BC166623
HIP Clone ID 481143
HIP Master Clone ID 398871
GI 187252474

Property:

Collection: NIH_MGC_435
Collection: OCAB22
Collection: The ORFeome Collaboration

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 3969 Homo sapiens CLOSED 116966 WDR17 WD repeat domain 17
Insert1
Size (bp)3969
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 116966
Gene SymbolWDR17
Gene NameWD repeat domain 17
Keyword

Insert Sequence:

GTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGGCTTGGATGACTTACATTTCAAATTGGTTTGAGCAAGATGATTGGTATGAAGGACTACAAAGAGCAAACATGTCCCAGGTAAGGCAAGTGGGATTGCTGGCTGCTGGATGTCAGCCATGGAACAAGGATGTATGTGCTGCCAGTGGAGACAGGTTTGCATATTGTGCGACCCTGGCTATCTATATTTATCAGTTGGATCACCGTTATAATGAATTCAAACTTCACGCAATTATGTCTGAACATAAAAAAACAATCACAGCAATTTCTTGGTGTCCACATAATCCTGATCTGTTTGCAAGTGGCAGTACTGATAATTTAGTGATCATTTGGAATGTTGCAGAACAAAAAGTCATTGCTAAACTCGACAGTACAAAAGGGATCCCTGCTTCTCTTAGTTGGTGCTGGAATGCAGAGGATGTGGTGGCATTTGTTTCCCACAGAGGCCCACTGTTCATTTGGACCATCTCAGGACCAGATAGTGGAGTGATTGTACACAAAGATGCTCATAGCTTCTTGTCTGATATCTGTATGTTCAGATGGCATACACACCAAAAGGGGAAAGTTGTGTTTGGTCATATTGATGGAAGTCTATCAATTTTTCATCCAGGTAATAAAAATCAGAAACATGTTTTGAGACCAGAATCTCTTGAAGGGACAGATGAAGAGGATCCAGTTACGGCCTTGGAATGGGACCCACTATCTACTGATTATCTTCTAGTGGTTAATTTGCATTATGGAATTCGCCTGGTAGATTCTGAATCACTTTCTTGCATAACAACATTTAATCTTCCCAGTGCAGCAGCTTCTGTACAGTGCTTAGCCTGGGTTCCCAGTGCTCCTGGGATGTTTATAACTGGAGATTCTCAAGTGGGTGTTTTACGCATTTGGAATGTTTCAAGAACAACACCTATTGATAATCTTAAATTAAAGAAAACAGGATTTCACTGCTTACATGTACTTAATTCTCCTCCAAGAAAAAAGTTTTCAGTCCAATCTCCAACCAAAAATCATTATACATCCTCAACAAGCGAAGCAGTTCCACCCCCAACTTTAACACAGAATCAAGCATTTTCTCTTCCTCCTGGTCATGCAGTGTGTTGTTTCTTGGATGGTGGAGTTGGACTTTATGATATGGGAGCTAAGAAGTGGGATTTTCTTAGAGACTTGGGACATGTGGAAACTATCTTTGACTGCAAATTCAAACCTGACGATCCTAATCTTTTAGCAACAGCTTCATTTGATGGCACTATAAAAGTCTGGGATATAAACACATTAACAGCAGTGTACACATCCCCGGGTAATGAAGGTGTTATTTATTCCCTTTCTTGGGCTCCAGGTGGTTTAAATTGTATTGCTGGGGGAACTTCCCGAAATGGTGCTTTTATTTGGAATGTTCAAAAGGGCAAAATTATACAACGATTTAATGAGCATGGAACAAATGGAATATTCTGCATTGCCTGGAGTCATAAAGATTCTAAAAGAATAGCAACCTGCAGCAGTGATGGTTTCTGTATTATTCGAACAATTGATGGTAAAGTGCTACACAAATATAAACATCCAGCTGCAGTGTTTGGTTGTGATTGGAGCCAAAACAATAAAGACATGATAGCCACTGGCTGTGAAGACACAAATGTTCGTGTTTATTATGTAGCCACCAGCTCAGATCAACCATTGAAAGTATTTAGTGGGCATACAGCAAAAGTGTTTCATGTTAAATGGTCTCCTCTGAGAGAGGGAATTCTTTGCAGTGGTTCTGATGATGGTACCGTTCGAATCTGGGATTATACTCAGGATGCTTGCATCAATATTCTTAATGGACACACTGCACCTGTGAGAGGATTAATGTGGAATACTGAGATTCCATATCTGCTCATATCTGGCAGCTGGGACTATACTATAAAAGTATGGGACACTCGAGAAGGAACTTGTGTGGATACTGTGTATGATCACGGTGCAGATGTATATGGTTTAACCTGCCATCCCAGTCGCCCCTTCACTATGGCCTCTTGCTCCCGTGACTCTACAGTGAGACTCTGGTCATTAACAGCCTTAGTCACTCCTGTACAAATAAATATTCTGGCAGACAGATCTTGGGAAGAAATTATTGGGAACACTGATTATGCTATAGAACCAGGCACTCCTCCTCTACTGTGTGGTAAAGTGTCAAGAGATATTAGACAGGAAATAGAAAAACTAACTGCTAATTCTCAAGTGAAAAAACTAAGATGGTTCTCAGAATGTTTATCTCCTCCAGGTGGCAGTGACAATTTATGGAACTTGGTTGCTGTGATAAAAGGACAGGATGATAGCTTACTTCCTCAGAACTACTGCAAAGGAATAATGCACTTGAAACATCTGATTAAATTTAGAACATCTGAAGCTCAAGAACTAACAACAGTCAAGATGTCTAAATTTGGTGGTGGTATTGGTGTACCTGCTAAAGAGGAAAGACTGAAGGAAGCTGCTGAAATCCACTTGAGATTAGGACAAATTCAGAGATACTGTGAACTTATGGTTGAACTTGGAGAGTGGGACAAAGCCCTGTCAATTGCACCAGGAGTCTCTGTGAAATACTGGAAGAAGTTAATGCAGAGGAGAGCTGACCAATTAATCCAGGAAGATAAGGATGATGTCATTCCATACTGCATAGCCATTGGTGATGTGAAAAAGCTAGTCCATTTTTTCATGTCAAGAGGTCAGCTTAAAGAAGCTCTGCTTGTTGCACAGGCTGCTTGTGAAGGAAATATGCAGCCCTTACATGTTTCCGTGCCTAAAGGAGCTTCATATTCTGATGATATCTACAAGGAAGACTTTAATGAACTCCTGCACAAAGTCAGTAAAGAACTGGCAGAATGGTATTTTCAAGATGGTCGAGCAGTACTAGCCGCATGTTGCCATCTTGCCATAGATAATATTGAGCTTGCTATGGCATACCTGATTCGCGGAAATGAACTGGAGTTGGCAGTCTGTGTGGGCACAGTACTAGGAGAGTCTGCAGCACCAGCAACCCACTATGCCTTAGAATTACTGGCGAGAAAGTGCATGATGATTTCAGTATGCTTTCCATGTGTTGGATACAGTGTCCCCTTTTGTTACGTTAACAGGAATTTGGCAGCTGATCTTCTTCTGATGATTCCTGATAATGAACTACATTTAATAAAACTCTGTGCTTTCTACCCAGGATGTACTGAAGAGATAAATGACCTTCATGATAAGTGTAAGCTACCCACAGTGGAAGAATGTATGCAGTTAGCTGAGACAGCCCGTGCAGATGACAATATATTTGAAACTGTAAAATATTACTTGTTAAGTCAAGAACCTGAAAAAGCCCTTCCTATTGGTATTAGCTTTGTTAAAGAATACATCAGTAGCTCAGACTGGACTTTGGATACCATATACCCTGTTCTTGACCTACTGAGCTATATTCGTACTGAAAAATTACTCTTGCATACGTGTACTGAAGCTCGAAATGAGTTGCTGATATTATGTGGTTACATTGGTGCATTACTGGCTATCAGAAGACAGTACCAAAGCATTGTTCCAGCACTTTATGAGTACACAAGTCAGCTATTAAAACGTCGGGAGGTGTCAGTACCTTTAAAAATTGAATATCTTTCTGAGGAATTGGATGCATGGAGAGCTTGCACACAGTCCACCAACAGATCATTAGAAGACTCTCCGTATACACCCCCTTCTGATTCACAAAGAATGATTTATGCAACTTTATTAAAGAGACTAAAAGAAGAGTCACTGAAAGGAATTATTGGACCAGATTATGTGACTGGATCAAATCTTCCAAGTCATTCTGATATTCACATTTCTTGTCTTACGGGATTAAAAATCCAGGGCCCTGTGTTTTTCCTTGAAGACGGGAAATCTGCTATCTCCTTGAATGATGCTTTGATGTGGGCAAAGGTGAATCCATTCTCACCTTTAGGGACTGGAATACGACTCAATCCATTC TAGGGCCTCATGGGCCCAGCTTTCTTGTAC

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 4125
Start on reference sequence 157

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGGCTTGGATGACTTACATTTCAAATTGGTTTGAGCAAGATGATTGGTATGAAGGACTACAAAGAGCAAACATGTCCCAGGTAAGGCAAGTGGGATTGCTGGCTGCTGGATGTCAGCCATGGAACAAGGATGTATGTGCTGCCAGTGGAGACAGGTTTGCATATTGTGCGACCCTGGCTATCTATATTTATCAGTTGGATCACCGTTATAATGAATTCAAACTTCACGCAATTATGTCTGAACATAAAAAAACAATCACAGCAATTTCTTGGTGTCCACATAATCCTGATCTGTTTGCAAGTGGCAGTACTGATAATTTAGTGATCATTTGGAATGTTGCAGAACAAAAAGTCATTGCTAAACTCGACAGTACAAAAGGGATCCCTGCTTCTCTTAGTTGGTGCTGGAATGCAGAGGATGTGGTGGCATTTGTTTCCCACAGAGGCCCACTGTTCATTTGGACCATCTCAGGACCAGATAGTGGAGTGATTGTACACAAAGATGCTCATAGCTTCTTGTCTGATATCTGTATGTTCAGATGGCATACACACCAAAAGGGGAAAGTTGTGTTTGGTCATATTGATGGAAGTCTATCAATTTTTCATCCAGGTAATAAAAATCAGAAACATGTTTTGAGACCAGAATCTCTTGAAGGGACAGATGAAGAGGATCCAGTTACGGCCTTGGAATGGGACCCACTATCTACTGATTATCTTCTAGTGGTTAATTTGCATTATGGAATTCGCCTGGTAGATTCTGAATCACTTTCTTGCATAACAACATTTAATCTTCCCAGTGCAGCAGCTTCTGTACAGTGCTTAGCCTGGGTTCCCAGTGCTCCTGGGATGTTTATAACTGGAGATTCTCAAGTGGGTGTTTTACGCATTTGGAATGTTTCAAGAACAACACCTATTGATAATCTTAAATTAAAGAAAACAGGATTTCACTGCTTACATGTACTTAATTCTCCTCCAAGAAAAAAGTTTTCAGTCCAATCTCCAACCAAAAATCATTATACATCCTCAACAAGCGAAGCAGTTCCACCCCCAACTTTAACACAGAATCAAGCATTTTCTCTTCCTCCTGGTCATGCAGTGTGTTGTTTCTTGGATGGTGGAGTTGGACTTTATGATATGGGAGCTAAGAAGTGGGATTTTCTTAGAGACTTGGGACATGTGGAAACTATCTTTGACTGCAAATTCAAACCTGACGATCCTAATCTTTTAGCAACAGCTTCATTTGATGGCACTATAAAAGTCTGGGATATAAACACATTAACAGCAGTGTACACATCCCCGGGTAATGAAGGTGTTATTTATTCCCTTTCTTGGGCTCCAGGTGGTTTAAATTGTATTGCTGGGGGAACTTCCCGAAATGGTGCTTTTATTTGGAATGTTCAAAAGGGCAAAATTATACAACGATTTAATGAGCATGGAACAAATGGAATATTCTGCATTGCCTGGAGTCATAAAGATTCTAAAAGAATAGCAACCTGCAGCAGTGATGGTTTCTGTATTATTCGAACAATTGATGGTAAAGTGCTACACAAATATAAACATCCAGCTGCAGTGTTTGGTTGTGATTGGAGCCAAAACAATAAAGACATGATAGCCACTGGCTGTGAAGACACAAATGTTCGTGTTTATTATGTAGCCACCAGCTCAGATCAACCATTGAAAGTATTTAGTGGGCATACAGCAAAAGTGTTTCATGTTAAATGGTCTCCTCTGAGAGAGGGAATTCTTTGCAGTGGTTCTGATGATGGTACCGTTCGAATCTGGGATTATACTCAGGATGCTTGCATCAATATTCTTAATGGACACACTGCACCTGTGAGAGGATTAATGTGGAATACTGAGATTCCATATCTGCTCATATCTGGCAGCTGGGACTATACTATAAAAGTATGGGACACTCGAGAAGGAACTTGTGTGGATACTGTGTATGATCACGGTGCAGATGTATATGGTTTAACCTGCCATCCCAGTCGCCCCTTCACTATGGCCTCTTGCTCCCGTGACTCTACAGTGAGACTCTGGTCATTAACAGCCTTAGTCACTCCTGTACAAATAAATATTCTGGCAGACAGATCTTGGGAAGAAATTATTGGGAACACTGATTATGCTATAGAACCAGGCACTCCTCCTCTACTGTGTGGTAAAGTGTCAAGAGATATTAGACAGGAAATAGAAAAACTAACTGCTAATTCTCAAGTGAAAAAACTAAGATGGTTCTCAGAATGTTTATCTCCTCCAGGTGGCAGTGACAATTTATGGAACTTGGTTGCTGTGATAAAAGGACAGGATGATAGCTTACTTCCTCAGAACTACTGCAAAGGAATAATGCACTTGAAACATCTGATTAAATTTAGAACATCTGAAGCTCAAGAACTAACAACAGTCAAGATGTCTAAATTTGGTGGTGGTATTGGTGTACCTGCTAAAGAGGAAAGACTGAAGGAAGCTGCTGAAATCCACTTGAGATTAGGACAAATTCAGAGATACTGTGAACTTATGGTTGAACTTGGAGAGTGGGACAAAGCCCTGTCAATTGCACCAGGAGTCTCTGTGAAATACTGGAAGAAGTTAATGCAGAGGAGAGCTGACCAATTAATCCAGGAAGATAAGGATGATGTCATTCCATACTGCATAGCCATTGGTGATGTGAAAAAGCTAGTCCATTTTTTCATGTCAAGAGGTCAGCTTAAAGAAGCTCTGCTTGTTGCACAGGCTGCTTGTGAAGGAAATATGCAGCCCTTACATGTTTCCGTGCCTAAAGGAGCTTCATATTCTGATGATATCTACAAGGAAGACTTTAATGAACTCCTGCACAAAGTCAGTAAAGAACTGGCAGAATGGTATTTTCAAGATGGTCGAGCAGTACTAGCCGCATGTTGCCATCTTGCCATAGATAATATTGAGCTTGCTATGGCATACCTGATTCGCGGAAATGAACTGGAGTTGGCAGTCTGTGTGGGCACAGTACTAGGAGAGTCTGCAGCACCAGCAACCCACTATGCCTTAGAATTACTGGCGAGAAAGTGCATGATGATTTCAGTATGCTTTCCATGTGTTGGATACAGTGTCCCCTTTTGTTACGTTAACAGGAATTTGGCAGCTGATCTTCTTCTGATGATTCCTGATAATGAACTACATTTAATAAAACTCTGTGCTTTCTACCCAGGATGTACTGAAGAGATAAATGACCTTCATGATAAGTGTAAGCTACCCACAGTGGAAGAATGTATGCAGTTAGCTGAGACAGCCCGTGCAGATGACAATATATTTGAAACTGTAAAATATTACTTGTTAAGTCAAGAACCTGAAAAAGCCCTTCCTATTGGTATTAGCTTTGTTAAAGAATACATCAGTAGCTCAGACTGGACTTTGGATACCATATACCCTGTTCTTGACCTACTGAGCTATATTCGTACTGAAAAATTACTCTTGCATACGTGTACTGAAGCTCGAAATGAGTTGCTGATATTATGTGGTTACATTGGTGCATTACTGGCTATCAGAAGACAGTACCAAAGCATTGTTCCAGCACTTTATGAGTACACAAGTCAGCTATTAAAACGTCGGGAGGTGTCAGTACCTTTAAAAATTGAATATCTTTCTGAGGAATTGGATGCATGGAGAGCTTGCACACAGTCCACCAACAGATCATTAGAAGACTCTCCGTATACACCCCCTTCTGATTCACAAAGAATGATTTATGCAACTTTATTAAAGAGACTAAAAGAAGAGTCACTGAAAGGAATTATTGGACCAGATTATGTGACTGGATCAAATCTTCCAAGTCATTCTGATATTCACATTTCTTGTCTTACGGGATTAAAAATCCAGGGCCCTGTGTTTTTCCTTGAAGACGGGAAATCTGCTATCTCCTTGAATGATGCTTTGATGTGGGCAAAGGTGAATCCATTCTCACCTTTAGGGACTGGAATACGACTCAATCCATTC TAGGGCCTCATGGGCCCAGCTTTCTTGTACTACAAAGTTGGCATTATAAAAAATAATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGCCTCCTCTAGACCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTGCCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAACCCTCGAGCCACCCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCG

Vector Information:

Vector Name:pENTR223.1
Type:bacterial plasmid
Description:Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Properties:Gateway, donor (entry), recombinational cloning
Comments:Additional information about this vector is available from the commercial website and at the ORFeome website http://www.orfeomecollaboration.org/html/vectors.shtml.
Map:pENTR223-1-map.doc
Sequence:pENTR223_1.txt
Size (bp):4311
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial spectinomycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL spectinomycin Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.

Authors:

Author Name Author Type
The ORFeome Collaboration Consortium