Clone: EvNO00292861 ← Click Here To Order

Clone ID:EvNO00292861
Is Verified:N
Status:AVAILABLE
Source:HIP
Description:Lentiviral cDNA expression vector, with C-terminal 6xHis tag and N-terminal HA-Flag tag separated by a TEV protease cleavage site; Ampicillin and chloromphenical resistance in bacteria; blasticidin resistance in mammalian cells; CRE-Lox recombinational or restriction enzyme cloning.
Comments:
Type:No insert
Verification Method:
Distribution:No restriction
Special MTA:

Related Identifiers:

Sequencing Information:

Phred Score: 777
Date: 2018-03-19

Last Passing Sequencing Read:

NNCCCTCGTCAGCATTACANACTCGTTAGTGACCGTCAGATCGCCTGGAG ACGCCATCCACGCTGATTTTGACCTCTATAGAAGACACCGGGACCGATCC AGCCTCCGGCTAGCCATAATACGACTCACTATAGGGTTTAAACTTAAGAC ACCATGTACCCCTACGACGTGCCCGACTACGCCGAAAACCTATACTTCCA ATCACTGCAGGACTACAAGGACGACGATGACAAGGTCGACATAACTTCGT ATAGCATACATTATACGAAGTTATAGATCCAATATTATTGAAGCATTTAT CAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAA TAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACG TGGATCTCGAGCTCAAGCTTCGAATTCAGGGTTTCCTTGACAATATCATA CTTATCCTGTCCCTTTTTTTTCCACAGCTACCGGTCCACCACCACCACCA CCACTAACCCGGGGGATCCGCGGCCGCAAATTCCGCCCCTCTCCCTCCCC CCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGT TTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGG GCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTC CCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAG TTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGC AGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCC ACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCCCGTTG TGAATTGGATAGTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCA CAAGGGGCTGAAGGATGCCCAAAAGGTACCCCATTGTAGGGGATCTGATC GGGGGCCCCGGGGCCAATGCTTTACTGGGGTTAACCGAGGTTAAAAAAAC GTTTGGGCCCCCCGAAACACGGGAACGTGGTTTCCCTTTAAAAACCCGAG ATAAGCTTGCCCAACATGGCCAAACCTTTGCCCCAAAAAAACCCCCTCCT TGAAGAAAAAGGGTACAATCAAAGATTTCCCTTTTTGAAAATTAAGGTTC CGGGGGATTTCTTATAGAGGCGGGCTTTCGGGGGGAAGGATATCTTTTAC GGGGGAACTGGTGAAACCGGGGGTGTGGACTGGTGGTGTGGGAACTGAAA CTTATTTTTTCCCATTAGAATGAAAAGGGATTTGACCCGGGAAGGGCAAA GGTTTCTATTTCCCGGTTAAACCTGTAAGAGTGGACACCCCGCTGTGTTT AATTCCCCGTTGTGGGGAAAATTACTAATAGTCTTTCTGGAACCTTTACT

Vector Information:

Vector Name:pCW62
Type:bacterial plasmid
Description:Lentiviral cDNA expression vector, with C-terminal 6xHis tag and N-terminal HA-Flag tag separated by a TEV protease cleavage site; Ampicillin and chloromphenical resistance in bacteria; blasticidin resistance in mammalian cells; CRE-Lox recombinational or restriction enzyme cloning.
Properties:mammalian expression
Comments:
Map:pCW62-Map.pdf
Sequence:pCW62-DNA-Sequence.dat
Size (bp):7520
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y T1/T5 phage resistant DH5-alpha

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
bacterial chloramphenicol
mammalian blasticidin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial Ampicillin, Chloramphenicol 50 ug/ml ampicillin or carbenicillin, 25 ug/ml chloromphenical and 7 % sucrose Use this for CRE-lox cloning media and for clones containing inserts