Clone: HsCD00289105

Clone ID:HsCD00289105
Is Verified:Y
Status:AVAILABLE
Source:The ORFeome Collaboration
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

Original Clone ID 36096
HIP Clone ID 472342
HIP Master Clone ID 395260

Property:

Collection: The ORFeome Collaboration

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 1251 Homo sapiens FUSION 405 ARNT aryl hydrocarbon receptor nuclear translocator
Insert1
Size (bp)1251
SpeciesHomo sapiens
FormatFUSION
Tissue Source
Species Specific ID 405
Gene SymbolARNT
Gene Namearyl hydrocarbon receptor nuclear translocator
Keyword

Insert Sequence:

ATGGCGGCGACTACTGCCAACCCCGAAATGACATCAGATGTACCATCACTGGGTCCAGCCATTGCCTCTGGAAACTCTGGACCTGGAATTCAAGGTGGAGGAGCCATTGTCCAGAGGGCTATTAAGCGGCGACCAGGGCTGGATTTTGATGATGATGGAGAAGGGAACAGTAAATTTTTGAGGTGTGATGATGATCAGATGTCTAACGATAAGGAGCGGTTTGCCAGGTCGGATGATGAGCAGAGCTCTGCGGATAAAGAGAGACTTGCAAGGGAAAATCACAGTGAAATTGAACGGCGGCGACGGAACAAGATGACAGCCTACATCACAGAACTGTCAGATATGGTACCCACATGTAGTGCCCTGGCTCGAAAACCAGACAAGCTAACCATCTTACGCATGGCAGTTTCTCACATGAAGTCCTTGCGGGGAACTGGCAACACATCCACTGATGGCTCCTATAAGCCGTCTTTCCTCACTGATCAGGAACTGAAACATTTGATCTTGGAGGCAGCAGATGGCTTTCTGTTTATTGTCTCATGTGAGACAGGCAGGGTGGTGTATGTCTCTGACTCCGTGACTCCTGTTTTGAACCAGCAACAGTCTGAATGGTTTGGCAGCACACTCTATGATCAGGTGCACCCAGATGATGTGGATAAACTTCGTGAGCAGCTTTCCACTTCAGAAAATGCCCTGACAGGGCGTATCCTGGATCTAAAGACTGGAACAGTGAAAAAGGAAGGTCAGCAGTCTTCCATGAGAATGTGTATGGGCTCAAGGAGATCGTTTATTTGCCGAATGAGGTGTGGCAGTAGCTCTGTGGACCCAGTTTCTGTGAATAGGCTGAGCTTTGTGAGGAACAGATGCAGGAATGGACTTGGCTCTGTAAAGGATGGGGAACCTCACTTCGTGGTGGTCCACTGCACAGGCTACATCAAGGCCTGGCCCCCAGCAGGTGTTTCCCTCCCAGATGATGACCCAGAGGCTGGCCAGGGAAGCAAGTTTTGCCTAGTGGCCATTGGCAGATTGCAGGTAACTAGTTCTCCCAACTGTACAGACATGAGTAATGTTTGTCAACCAACAGAGTTAATCTCCCGACACAACATTGAGGGTATCTTCACTTTTGTGGATCACCGCTGTGTGGCTACTGTTGGCTACCAGCCACAGGAACTCTTAGGAAAGAATATTGTAGAATTCTGTCATCCTGAAGACCAGCAGCTTCTAAGAGACAGCTTCCAACAGGAACTCTAC

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 1387
Start on reference sequence 137

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGATGGCGGCGACTACTGCCAACCCCGAAATGACATCAGATGTACCATCACTGGGTCCAGCCATTGCCTCTGGAAACTCTGGACCTGGAATTCAAGGTGGAGGAGCCATTGTCCAGAGGGCTATTAAGCGGCGACCAGGGCTGGATTTTGATGATGATGGAGAAGGGAACAGTAAATTTTTGAGGTGTGATGATGATCAGATGTCTAACGATAAGGAGCGGTTTGCCAGGTCGGATGATGAGCAGAGCTCTGCGGATAAAGAGAGACTTGCAAGGGAAAATCACAGTGAAATTGAACGGCGGCGACGGAACAAGATGACAGCCTACATCACAGAACTGTCAGATATGGTACCCACATGTAGTGCCCTGGCTCGAAAACCAGACAAGCTAACCATCTTACGCATGGCAGTTTCTCACATGAAGTCCTTGCGGGGAACTGGCAACACATCCACTGATGGCTCCTATAAGCCGTCTTTCCTCACTGATCAGGAACTGAAACATTTGATCTTGGAGGCAGCAGATGGCTTTCTGTTTATTGTCTCATGTGAGACAGGCAGGGTGGTGTATGTCTCTGACTCCGTGACTCCTGTTTTGAACCAGCAACAGTCTGAATGGTTTGGCAGCACACTCTATGATCAGGTGCACCCAGATGATGTGGATAAACTTCGTGAGCAGCTTTCCACTTCAGAAAATGCCCTGACAGGGCGTATCCTGGATCTAAAGACTGGAACAGTGAAAAAGGAAGGTCAGCAGTCTTCCATGAGAATGTGTATGGGCTCAAGGAGATCGTTTATTTGCCGAATGAGGTGTGGCAGTAGCTCTGTGGACCCAGTTTCTGTGAATAGGCTGAGCTTTGTGAGGAACAGATGCAGGAATGGACTTGGCTCTGTAAAGGATGGGGAACCTCACTTCGTGGTGGTCCACTGCACAGGCTACATCAAGGCCTGGCCCCCAGCAGGTGTTTCCCTCCCAGATGATGACCCAGAGGCTGGCCAGGGAAGCAAGTTTTGCCTAGTGGCCATTGGCAGATTGCAGGTAACTAGTTCTCCCAACTGTACAGACATGAGTAATGTTTGTCAACCAACAGAGTTAATCTCCCGACACAACATTGAGGGTATCTTCACTTTTGTGGATCACCGCTGTGTGGCTACTGTTGGCTACCAGCCACAGGAACTCTTAGGAAAGAATATTGTAGAATTCTGTCATCCTGAAGACCAGCAGCTTCTAAGAGACAGCTTCCAACAGGAACTCTACATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGCCTCCTCTAGACCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTACCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAACCCTCGAGCCACCCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT

Sequencing Information:

Phred Score: 813
Date: 2014-09-18

Last Passing Sequencing Read:

AGTTGGGTAGGGTTTTAGTAGTTTAGGAAGGTTTNNNNNGGTGNNAGGTNNNNNGCGCAAAGATTTATTTGACTGAAGTGACCGNTTCGTTGCTCAAATTGATGAGCAATGGCTTTGCCTTTATGGCAACTTTGTACAAAAAAGTTGGCATGGCGGCGACTACTGCCAACCCCGAAATGACATCAGATGTACCATCACTGGGTCCAGCCATTGCCTCTGGAAACTCTGGACCTGGAATTCAAGGTGGAGGAGCCATTGTCCAGAGGGCTATTAAGCGGCGACCAGGGCTGGATTTTGATGATGATGGAGAAGGGAACAGTAAATTTTTGAGGTGTGATGATGATCAGATGTCTAACGATAAGGAGCGGTTTGCCAGGTCGGATGATGAGCAGAGCTCTGCGGATAAAGAGAGACTTGCAAGGGAAAATCACAGTGAAATTGAACGGCGGCGACGGAACAAGATGACAGCCTACATCACAGAACTGTCAGATATGGTACCCACATGTAGTGCCCTGGCTCGAAAACCAGACAAGCTAACCATCTTACGCATGGCAGTTTCTCACATGAAGTCCTTGCGGGGAACTGGCAACACATCCACTGATGGCTCCTATAAGCCGTCTTTCCTCACTGATCAGGAACTGAAACATTTGATCTTGGAGGCAGCAGATGGCTTTCTGTTTATTGTCTCATGTGAGACAGGCAGGGTGGTGTATGTCTCTGACTCCGTGACTCCTGTTTTGAACCAGCAACAGTCTGAATGGTTTGGCAGCACACTCTATGATCAGGTGCACCCAGATGATGTGGATAAACTTCGTGAGCAGCTTTCCACTTCAGAAAATGCCCTGACAGGGCGTATCCTGGATCTAAAGACTGGAACAGTGAAAAAGGAAGGTCAGCAGTCTTCCATGAGAATGTGTATGGGCTCAAGGAGATCGTTTATTTGCCGAATGAGGTGTGGCAGTAGCTCTGTGGACCCAGTTTCTGTGAATAGGCTGAGCTTTGTGAGGAACAGATGCAGGAATGGATTTGGCTCTGTAAAGGATGGGAAACCTCACTTCGTGGGGGTCCATGCCACAGGCTACATCAGGGCTTGGCCCCCAACAGGTTGTTTCCTCCCAGTAGAATGACTCAAGGCTGGCCAGGAAACAAATTTTGGCTAAGGGCACATTGCAAAATGCAGGAAAACTATTCTCCAACCTGTCAAACAAGAAATATGTTTTTCAACCAACAAATTAAACTTCCAACCAACATTAGGGTTCTTCCCTTTTGGGAACACCCGTGGGGGCGACGGTGTGCTCCACCCCAGGAACTTTTAGGAAAAATATTGTAAATTCTGTCTCCTAAACAACAACCTTTTAAAACAGTTTCCAAAGAGACTTCCCAATTTTTGTGAAAATGTGTTTAAGAAAAAATGTTTATATTTTGTTACAAAGGCCTCTTCCCCAAAAAA

Vector Information:

Vector Name:pENTR223
Type:bacterial plasmid
Description:Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Properties:recombinational cloning
Comments:Additional information about this vector is available from the commercial website and at the ORFeome website http://www.orfeomecollaboration.org/html/vectors.shtml; also see supplemental figure 1 of the paper PubMed ID 15489335.
Map:pDONR223.1.gif
Sequence:pENTR223-seq.doc
Size (bp):2815
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial spectinomycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL spectinomycin Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.

Authors:

Author Name Author Type
The ORFeome Collaboration Consortium