Clone: EvNO00285801 ← Click Here To Order

Clone ID:EvNO00285801
Is Verified:N
Status:AVAILABLE
Source:
Description:Yeast expression vector with ARS1, CEN4, Gal1-10 promoter; amp resistance (URA3 for yeast); recombinational cloning.
Comments:Empty vector contains the ccdB death cassette.
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Sequencing Information:

Phred Score: 857
Date: 2017-10-09

Last Passing Sequencing Read:

>28056-57_EvNO00285801-pBY011-3_A8 857 1478 46 931 NNNNNAACAAAANNNGCATACGGAACACTATACATGATTACGCCAGCTTG CATGCCATCACCACTTTGTACAGAAAGCTGAACGAGAAACGTAAAATGAT ATAAATATCAATATATTAAATTAGATTTTGCATAAAAAACAGACTACATA ATACTGTAAAACACAACATATCCAGTCACTATGGTCGACCTGCAGACTGG CTGTGTATAAGGGAGCCTGACATTTATATTCCCCAGAACATCAGGTTAAT GGCGTTTTTGATGTCATTTTCGCGGTGGCTGAGATCAGCCACTTCTTCCC CGATAACGGAGACCGGCACACTGGCCATATCGGTGGTCATCATGCGCCAG CTTTCATCCCCGATATGCACCACCGGGTAAAGTTCACGGGAGACTTTATC TGACAGCAGACGTGCACTGGCCAGGGGGATCACCATCCGTCGCCCGGGCG TGTCAATAATATCACTCTGTACATCCACAAACAGACGATAACGGCTCTCT CTTTTATAGGTGTAAACCTTAAACTGCATTTCACCAGCCCCTGTTCTCGT CAGCAAAAGAGCCGTTCATTTCAATAAACCGGGCGACCTCAGCCATCCCT TCCTGATTTTCCGCTTTCCAGCGTTCGGCACGCAGACGACGGGCTTCATT CTGCATGGTTGTGCTTACCAGACCGGAGATATTGACATCATATATGCCTT GAGCAACTGATAGCTGTCGCTGTCAACTGTCACTGTAATACGCTGCTTCA TAGCATACCTCTTTTTGACATACTTCGGGTATACATATCAGTATATATTC TTATACCGCAAAAATCAGCGCGCAAATACGCATACTGTTATCTGGCTTTT AGTAAGCCGGATCCACGCGTTTACGCCCCGCCCTGCCACTCATCGCAGTA CTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCANCAACGG CATGATGAACCTGAATCGNCCAGCGCATCAGCACCTTGTCGCCTTGCGTA TAATATTTGCCCATGNTGAAAACGGGGGCGAAGAAGTTGTCCATATTGNC CACGTTTAATCAAACTGNTGAACTCACCCAGGATGNCTGAGACAAAACAT ATTCTCATAACCCTTANGGAANTAGGCAGTTTTCACCGTACCCCCCATCT GGCAATATGTGTAGAACGCCGGAACTCTCTGTATTCCTCAGACGATAAAA CTTTCCTTGCTCTGGAACGGTTAACAGGGAAACTATCATTACCGCTCCGC TTTATGCTAGGAATCCAAAAATTTTAGGGGGCAAATGAAAAGCCAAAATT GGTTTTTTTTTCGTTTAAAGCCAAACCCCAAACCGTTTGGTTTACACAAA AGCCCAGTTTCATCCGGAAAAAGGGACGGTTTTCTTTTTTCATCNNNNNA AAAAAAAAAAAAAANAGAAGAGGGGCGCCCGGGGGGGAAGGGGAAAAAAA

Vector Information:

Vector Name:pBY011
Type:bacterial plasmid
Description:Yeast expression vector with ARS1, CEN4, Gal1-10 promoter; amp resistance (URA3 for yeast); recombinational cloning.
Properties:Gateway, acceptor (destination), inducible expression, yeast expression, yeast shuttle
Comments:This is a bacteria-yeast shuttle vector useful for expressing cDNAs in yeast that includes an auxotrophic marker for selection in yeast.
Map:pBY011_map.pdf
Sequence:pBY011.txt
Size (bp):7920
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DB3.1 T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
bacterial chloramphenicol

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial chloramphenicol, ampicillin LB with 35ug/ml chloramphenicol and 100ug/ml ampicillin