Clone: EvNO00025959 ← Click Here To Order

Clone ID:EvNO00025959
Is Verified:U
Status:AVAILABLE
Source:J. Kamil in Coen lab (BCMP/HMS)
Description:Mammalian expression vector with fluorescent tag (soluble modified GFP, smGFP), CMV promoter, lac promoter; kanamycin resistance (neomycin for mammalian selection); restriction enzyme cloning.
Comments:Likely to cause the bacterial strain harboring the plasmid to appear greenish in color.
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Original Clone ID pIRES2 lac smGFP
SYNONYM pIRES-lac-smGFP

Sequencing Information:

Phred Score: 903
Date: 2017-07-10

Last Passing Sequencing Read:

>27548-4_EvNO00025959-4-IRES-F_D1 903 1398 32 911 NNTTTCGGCGAGAGCAGAGGTACCCCATTGTATGGGATCTGATCTGGGGC CTCGGTACACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTA GGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATA ATATGGCCCCGCAATTACTGTGAGTTAGCTCACTCATTAGGCACCCCAGG CTTTACACTTTATACTTCCGGCTCGTATATTGTGTGGAATTGTGAGCGGA TAACAATTTCACACAGGAAACAGCTATGACCTTGATTACGCCAAGCTCGA AATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCGCGCGCCTGCAGG TCGACACTAGTGGATCCAAGGAGATATAACAATGAGTAAAGGAGAAGAAC TTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAAT GGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGG AAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCAT GGCCAACACTTGTCACTACTTTCACTTATGGTGTTCAATGCTTTTCAAGA TACCCAGATCATATGAAGCGGCACGACTTCTTCAAGAGCGCCATGCCTGA GGGATACGTGCAGGAGAGGACCATCTCTTTCAAGGACGACGGGAACTACA AGACACGTGCTGAAGTCAAGTTTGAGGGAGACACCCTCGTCAACAGGATC GAGCTTAAGGGAATCGATTTCAAGGAGGACGGANACATCCTCGGCCACAA GTTGGAATACAACTACAACTCCCACAACGTATACATCACGGCAGACAAAC AAAAGAATGGAATCAAAGCTAACTTCAAAATTAGACACAACATTGAAGAT GGAAGCGTTNCACTAGCAGACCATTATNCACAAATACTCCAATTGGCGAT GGCCCTGTCCTTTTNNACAGACACCATTACCNNTGTCACACATCTGCCCC TTCGAAAGATCCCNACGAAAAGAGAGAACACATGGTCCTTCTTGAGTTTG TACAGCTGCTGGGATACACATGGCATGGATGACTATACAANTAGAGCTCG AATCAAAAGCTCTCGAGAGTACTCAGATCATATCAGCATACACATTGTAG AGTTTACTGCTTAAAAACCTCCAAACCTCCCTGAACTGACATAAATGATG CATGTGTTGTACTGTTATGCGCTAAAGGTTACATAGCATAGCTCCATTCC CAAAGCTTTTTCCGCATCTATGGGTTGCCACCCCAGGTTCTAGGGAATGA ACGTAATTGTAAATCCGAATTGGAAACCCCTTTACAAGGCAAAGAACCTA

Vector Information:

Vector Name:pIRES2 lac smGFP
Type:bacterial plasmid
Description:Mammalian expression vector with fluorescent tag (soluble modified GFP, smGFP), CMV promoter, lac promoter; kanamycin resistance (neomycin for mammalian selection); restriction enzyme cloning.
Properties:bacterial expression, fluorescent marker, mammalian expression, ssDNA production, with tag/fusion/marker
Comments:Not clear pIRES2 or pIRES parent vector; clone donor notes smGFP (see PubMed ID 9484447) less toxic than GFP or EGFP in mammalian cells
Map:pIRES-lac-smGFP.pdf
Sequence:pIRES-lac-smGFP.txt
Size (bp):5544
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
EB5-alpha T1, T5 phage resistant Y EB5-alpha host as supplied by Edge BioSystems (cells may appear green from smGFP)

Antibiotic Selections:

Host Type Marker
bacterial kanamycin
mammalian neomycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 50ug/mL kanamycin Growth with the single antibiotic in LB at 37 degrees is recommended. Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.

Authors:

Author Name Author Type
Donald Coen Adademic researcher, clone donor's PI
Jeremy Kamil Academic researcher, clone donor

Publications:

PMID Title
9484447 Soluble, highly fluorescent variants of green fluorescent protein (GFP) for use in higher plants
10696429 Establishment of a lymphoblastoid cell line using a mutant MDV containing a green fluorescent protein expression cassette
15529969 Construction and characterization of Marek's disease viruses having green fluorescent protein expression tied directly or indirectly to phosphoprotein 38 expression