Clone: EvNO00025949 ← Click Here To Order

Clone ID:EvNO00025949
Is Verified:U
Status:AVAILABLE
Source:O'Shea lab (HU/HMS)
Description:Yeast fluorescent (RFP) vector with PTEF promoter; amp resistance (kanamycin for yeast); restriction enzyme cloning.
Comments:Similar but not identical to pKT146, pKT176, pKT178 clones also in the repository collection.
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:TSIEN

Related Identifiers:

Original Clone ID pFA6a-mRFP1-kanMX6
SYNONYM pFA6a-RFP-kanR

Sequencing Information:

Phred Score: 903
Date: 2015-10-07

Last Passing Sequencing Read:

TTTTNCCGAACCGGCGCTAGCCACTGTGGATCTGATATCATCGATGAATT CGAGCTCGTTTAAACTGGATGGCGGCGTTAGTATCGAATCGACAGCAGTA TAGCGACCAGCATTCACATACGATTGACGCATGATATTACTTTCTGCGCA CTTAACTTCGCATCTGGGCAGATGATGTCGAGGCGAAAAAAAATATAAAT CACGCTAACATTTGATTAAAATAGAACAACTACAATATAAAAAAACTATA CAAATGACAAGTTCTTGAAAACAAGAATCTTTTTATTGTCAGTACTGATT AGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGA TTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAA CTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGA TTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAA ATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGA GAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGC CATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATT CGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACA ATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCAT CAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCT GTTTTGCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACG GATAAAATGCTTGATGGTCGGAAGAGGGCATAATTCCGTCAGCCAGTTTA GTCTGACCATCTCATCTGTAACATCATGGNCAACGCTACCTTTGCCCATG TTCAGAAACACTCTGGCGCATCNGGCTCCCNATACATCGATAGATTGTCG CACCTGATTGCCCGACATATCGCGAGCCCATTTATACCATATAATCAGCA TCATGTTGAATTNATCGCGCCTCGAACGTGAGTCTTCCTACCATGTTGTT ATTGTCGATGGATGGAGACTGTTCCAGCAGATTTTAAGGAGTTTTGAGGA GAACTCGTGGCAATCTACCTTTAAATTCCTCGGNCCCGCTGGGAAATCAC CCCCTGGAAGGAGTTCCTGTCCAGTCGCACAGAACTATTTTGCTCCGCGG GCCCAATGTTGAGCAAGAATTCGGGTTTGCCATGAGGGAAACATTGCCCG ATGCCCAAAATAGAGGTTTGGCTCTTTGCGGGCCCCGGAAAGAAAAAATT CCTTCCCCGCGGGGGGGGACCCCCTTAACCCGAGAAAAAAATTTCCAAAT TTTTTTTTTATAAAAAAANNNNNNNNNNNNTTACAAAATTATCCCCCCCA TCCCCCCCGCGCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Vector Information:

Vector Name:pFA6a-mRFP1-kanMX6
Type:bacterial plasmid
Description:Yeast fluorescent (RFP) vector with PTEF promoter; amp resistance (kanamycin for yeast); restriction enzyme cloning.
Properties:fluorescent marker, multiple cloning site, yeast expression, yeast shuttle
Comments:
Map:pFA6a-mRFP-KanMX6.pdf
Sequence:pFA6a-mRFP-KanMX6.txt
Size (bp):4846
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
yeast kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
Erin O'Shea Academic reseracher, clone PI
James Falvo Academic researcher, clone donor and author
WK Huh Academic researcher, clone first author

Publications:

PMID Title
14562095 Global analysis of protein localization in budding yeast