Clone: EvNO00025938 ← Click Here To Order

Clone ID:EvNO00025938
Is Verified:U
Status:AVAILABLE
Source:J. Kamil in Coen lab (BCMP/HMS)
Description:Mammalian and in vitro expression vector with EF1-alpha promoter and T7, adds C-terminal Myc then His tag; amp resistance (neomycin for mammalian selection); CpoI-based in-frame, single-cut directional cloning.
Comments:
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Original Clone ID pEF1 Cpo Myc His

Sequencing Information:

Phred Score: 599
Date: 2017-05-09

Last Passing Sequencing Read:

>27190-10_EvNO00025938-2-T7_B2 599 1377 44 629 NCCTCTGCAGTACTTGGTACGGTCGAGTCCCCATTCGAACAAAACTCATC TCAGAAGAGGATCTGAATATGCATACCGGTCATCATCACCATCACCATTG AGTTTAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCAT CTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACT CCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAG TAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACATCTAGGGGG AGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGCTGGGCTCTATG GCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCTAGGGGGTATCCCCACGC GCCCTGTACCGGCGCATTAAGCGCGGTGGGTGTGGTGGTTACGCGCAGCG TGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTC CCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGCCAAGTTCTAAATCG GTGGCTCCCTTTATGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCA AAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCCTCGCCCTGATAG ACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGCGGACT CTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTG AATTATAAGGGATTTTGCCGATTTTCGCCTATTGGCTAAAAAAATGCATC TGATTTAACAAAAATTTAACGCCAATTAATTCTGCGGAAAGCGCGTCAAC CTATGGTGTGAAAACTCCCCAATCTTCCCCACCATGCATAAGTTAGCCAA AGTATGTATTTCAATTATCCAGTACTCCCGCGTGGAAAGCCCCCACGCTC CCAACCAGGAAAAGTATTTCAAGTATGCATTCCCAATTAGCTAACAACCA TAATTTCGCCCCCTAATCCTCACCTCCCCCCCCCAAATTTACCCTGATTC CCCCCCTTCCCCCCCCAATGCCGAATAACTTTTTTTAATTTATGCAAAAC CCAACACCCCCCTCCCCTTTAACTTTTCCAAATATTGTAAGGGGCTTTTT CCAACCCCTACCTTTTCATAAACCCCCCCCGAACTTTGACTTCTCCTTCC CGACTCTATCAAAAAAAAGTTTAAACATTTTTCCCAACCTCGAACAAAGT GGTGCCCCCAGATTTCCCCCCCTCTGTGGTGAAAGCCATTCTTCTATTAA TGGGGCACATAACAATCTCTTTCTCAATACGCCTGTCTCTCCCTTCTCCA

Vector Information:

Vector Name:pEF1 Cpo Myc His
Type:bacterial plasmid
Description:Mammalian and in vitro expression vector with EF1-alpha promoter and T7, adds C-terminal Myc then His tag; amp resistance (neomycin for mammalian selection); CpoI-based in-frame, single-cut directional cloning.
Properties:CpoI enzyme-based directional cloning, in vitro transcription, mammalian expression, multiple cloning site, ssDNA production, with tag/fusion/marker
Comments:Cloning into CpoI site can be used to create in-frame C-terminal Myc, His tagged fusion ORF
Map:pEF1-Cpo-Myc-His.pdf
Sequence:pEF1-Cpo-Myc-His.txt
Size (bp):6112
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
EB5-alpha T1, T5 phage resistant Y EB5-alpha host as supplied by Edge BioSystems

Antibiotic Selections:

Host Type Marker
bacterial ampicillin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
Donald Coen Adademic researcher, clone donor's PI
Jeremy Kamil Academic researcher, clone donor