Clone: ScCD00025041

Clone ID:ScCD00025041
Is Verified:Y
Status:AVAILABLE
Source:HIP
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

Original Clone ID FLH202573.01X
HIP Clone ID 202573
HIP Master Clone ID 177284

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 2049 Saccharomyces cerevisiae CLOSED Genomic DNA template YJL034W KAR2 ATPase involved in protein import into the ER, also acts as a chaperone to mediate protein folding in the ER and may play a role in ER export of soluble proteins; regulates the unfolded protein response via interaction with Ire1p
Insert1
Size (bp)2049
SpeciesSaccharomyces cerevisiae
FormatCLOSED
Tissue SourceGenomic DNA template
Species Specific ID YJL034W
Gene SymbolKAR2
Gene NameATPase involved in protein import into the ER, also acts as a chaperone to mediate protein folding in the ER and may play a role in ER export of soluble proteins; regulates the unfolded protein response via interaction with Ire1p
Keyword

Insert Sequence:

ATGTTTTTCAACAGACTAAGCGCTGGCAAGCTGCTGGTACCACTCTCCGTGGTCCTGTACGCCCTTTTCGTGGTAATATTACCTTTACAGAATTCTTTCCACTCCTCCAATGTTTTAGTTAGAGGTGCCGATGATGTAGAAAACTACGGAACTGTTATCGGTATTGACTTAGGTACTACTTATTCCTGTGTTGCTGTGATGAAAAATGGTAAGACTGAAATTCTTGCTAATGAGCAAGGTAACAGAATCACCCCATCTTACGTGGCATTCACCGATGATGAAAGATTGATTGGTGATGCTGCAAAGAACCAAGTTGCTGCCAATCCTCAAAACACCATCTTCGACATTAAGAGATTGATCGGTTTGAAATATAACGACAGATCTGTTCAGAAGGATATCAAGCACTTGCCATTTAATGTGGTTAATAAAGATGGGAAGCCCGCTGTAGAAGTAAGTGTCAAAGGAGAAAAGAAGGTTTTTACTCCAGAAGAAATTTCTGGTATGATCTTGGGTAAGATGAAACAAATTGCCGAAGATTATTTAGGCACTAAGGTTACCCATGCTGTCGTTACTGTTCCTGCTTATTTCAATGACGCGCAAAGACAAGCCACCAAGGATGCTGGTACCATCGCTGGTTTGAACGTTTTGAGAATTGTTAATGAACCAACCGCAGCCGCCATTGCCTACGGTTTGGATAAATCTGATAAGGAACATCAAATTATTGTTTATGATTTGGGTGGTGGTACTTTCGATGTCTCTCTATTGTCTATTGAAAACGGTGTTTTCGAAGTCCAAGCCACTTCTGGTGATACTCATTTAGGTGGTGAAGATTTTGACTATAAGATCGTTCGTCAATTGATAAAAGCTTTCAAGAAGAAGCATGGTATTGATGTGTCTGACAACAACAAGGCCCTAGCTAAATTGAAGAGAGAAGCTGAAAAGGCTAAACGTGCCTTGTCCAGCCAAATGTCCACCCGTATTGAAATTGACTCCTTCGTTGATGGTATCGACTTAAGTGAAACCTTGACCAGAGCTAAGTTTGAGGAATTAAACCTAGATCTATTCAAGAAGACCTTGAAGCCTGTCGAGAAGGTTTTGCAAGATTCTGGTTTGGAAAAGAAGGATGTTGATGATATCGTTTTGGTTGGTGGTTCTACTAGAATTCCAAAGGTCCAACAATTGTTAGAATCATACTTTGATGGTAAGAAGGCCTCCAAGGGTATTAACCCAGATGAAGCTGTTGCATACGGTGCAGCCGTTCAAGCTGGTGTCTTATCCGGTGAAGAAGGTGTCGAAGATATTGTTTTATTGGATGTCAACGCTTTGACTCTTGGTATTGAAACCACTGGTGGTGTCATGACTCCATTAATTAAGAGAAATACTGCTATTCCTACAAAGAAATCCCAAATTTTCTCTACTGCCGTTGACAACCAACCAACCGTTATGATCAAGGTATACGAGGGTGAAAGAGCCATGTCTAAGGACAACAATCTATTAGGTAAGTTTGAATTAACCGGCATTCCACCAGCACCAAGAGGTGTACCTCAAATTGAAGTCACATTTGCACTTGACGCTAATGGTATTCTGAAGGTGTCTGCCACAGATAAGGGAACTGGTAAATCCGAATCTATCACCATCACTAACGATAAAGGTAGATTAACCCAAGAAGAGATTGATAGAATGGTTGAAGAGGCTGAAAAATTCGCTTCTGAAGACGCTTCTATCAAGGCCAAGGTTGAATCTAGAAACAAATTAGAAAACTACGCTCACTCTTTGAAAAACCAAGTTAATGGTGACCTAGGTGAAAAATTGGAAGAAGAAGACAAGGAAACCTTATTAGATGCTGCTAACGATGTTTTAGAATGGTTAGATGATAACTTTGAAACCGCCATTGCTGAAGACTTTGATGAAAAGTTCGAATCTTTGTCCAAGGTCGCTTATCCAATTACTTCTAAGTTGTACGGAGGTGCTGATGGTTCTGGTGCCGCTGATTATGACGACGAAGATGAAGATGACGATGGTGATTATTTCGAACACGACGAATTGTAG

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 2049
Start on reference sequence 1

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTATGTTTTTCAACAGACTAAGCGCTGGCAAGCTGCTGGTACCACTCTCCGTGGTCCTGTACGCCCTTTTCGTGGTAATATTACCTTTACAGAATTCTTTCCACTCCTCCAATGTTTTAGTTAGAGGTGCCGATGATGTAGAAAACTACGGAACTGTTATCGGTATTGACTTAGGTACTACTTATTCCTGTGTTGCTGTGATGAAAAATGGTAAGACTGAAATTCTTGCTAATGAGCAAGGTAACAGAATCACCCCATCTTACGTGGCATTCACCGATGATGAAAGATTGATTGGTGATGCTGCAAAGAACCAAGTTGCTGCCAATCCTCAAAACACCATCTTCGACATTAAGAGATTGATCGGTTTGAAATATAACGACAGATCTGTTCAGAAGGATATCAAGCACTTGCCATTTAATGTGGTTAATAAAGATGGGAAGCCCGCTGTAGAAGTAAGTGTCAAAGGAGAAAAGAAGGTTTTTACTCCAGAAGAAATTTCTGGTATGATCTTGGGTAAGATGAAACAAATTGCCGAAGATTATTTAGGCACTAAGGTTACCCATGCTGTCGTTACTGTTCCTGCTTATTTCAATGACGCGCAAAGACAAGCCACCAAGGATGCTGGTACCATCGCTGGTTTGAACGTTTTGAGAATTGTTAATGAACCAACCGCAGCCGCCATTGCCTACGGTTTGGATAAATCTGATAAGGAACATCAAATTATTGTTTATGATTTGGGTGGTGGTACTTTCGATGTCTCTCTATTGTCTATTGAAAACGGTGTTTTCGAAGTCCAAGCCACTTCTGGTGATACTCATTTAGGTGGTGAAGATTTTGACTATAAGATCGTTCGTCAATTGATAAAAGCTTTCAAGAAGAAGCATGGTATTGATGTGTCTGACAACAACAAGGCCCTAGCTAAATTGAAGAGAGAAGCTGAAAAGGCTAAACGTGCCTTGTCCAGCCAAATGTCCACCCGTATTGAAATTGACTCCTTCGTTGATGGTATCGACTTAAGTGAAACCTTGACCAGAGCTAAGTTTGAGGAATTAAACCTAGATCTATTCAAGAAGACCTTGAAGCCTGTCGAGAAGGTTTTGCAAGATTCTGGTTTGGAAAAGAAGGATGTTGATGATATCGTTTTGGTTGGTGGTTCTACTAGAATTCCAAAGGTCCAACAATTGTTAGAATCATACTTTGATGGTAAGAAGGCCTCCAAGGGTATTAACCCAGATGAAGCTGTTGCATACGGTGCAGCCGTTCAAGCTGGTGTCTTATCCGGTGAAGAAGGTGTCGAAGATATTGTTTTATTGGATGTCAACGCTTTGACTCTTGGTATTGAAACCACTGGTGGTGTCATGACTCCATTAATTAAGAGAAATACTGCTATTCCTACAAAGAAATCCCAAATTTTCTCTACTGCCGTTGACAACCAACCAACCGTTATGATCAAGGTATACGAGGGTGAAAGAGCCATGTCTAAGGACAACAATCTATTAGGTAAGTTTGAATTAACCGGCATTCCACCAGCACCAAGAGGTGTACCTCAAATTGAAGTCACATTTGCACTTGACGCTAATGGTATTCTGAAGGTGTCTGCCACAGATAAGGGAACTGGTAAATCCGAATCTATCACCATCACTAACGATAAAGGTAGATTAACCCAAGAAGAGATTGATAGAATGGTTGAAGAGGCTGAAAAATTCGCTTCTGAAGACGCTTCTATCAAGGCCAAGGTTGAATCTAGAAACAAATTAGAAAACTACGCTCACTCTTTGAAAAACCAAGTTAATGGTGACCTAGGTGAAAAATTGGAAGAAGAAGACAAGGAAACCTTATTAGATGCTGCTAACGATGTTTTAGAATGGTTAGATGATAACTTTGAAACCGCCATTGCTGAAGACTTTGATGAAAAGTTCGAATCTTTGTCCAAGGTCGCTTATCCAATTACTTCTAAGTTGTACGGAGGTGCTGATGGTTCTGGTGCCGCTGATTATGACGACGAAGATGAAGATGACGATGGTGATTATTTCGAACACGACGAATTGTAGAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAATAATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGCTTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGAAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGAATTGGTTAATTGGTTGTAACACTGGCAGAGCATTACGCTGACTTGACGGGACGGCGCAAGCTCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT

Vector Information:

Vector Name:pDONR221
Type:bacterial plasmid
Description:Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Properties:Gateway, donor (entry), recombinational cloning
Comments:The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Map:pdonr221_pdonrzeo_map.pdf
Sequence:pDONR221_FASTA.txt
Size (bp):4762
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 50ug/mL kanamycin Growth with the single antibiotic in LB at 37 degrees is recommended. Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.

Authors:

Author Name Author Type
HIP Academic Institute

Publications:

PMID Title
17322287 Approaching a complete repository of sequence-verified protein-encoding clones for Saccharomyces cerevisiae.