Clone: EvNO00023114 ← Click Here To Order

Clone ID:EvNO00023114
Is Verified:Y
Status:AVAILABLE
Source:HIP
Description:Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments:Constructed at HIP for expression of FLEXGene clones in pDNR-Dual (Cre/Lox recombinational cloning)
Type:No insert
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:

Related Identifiers:

Original Clone ID pJP1520

Sequencing Information:

Phred Score: 901
Date: 2013-05-02

Last Passing Sequencing Read:

CCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCCCAAGCTTCGATAACTTCGTATAGCATACATTATACGAAGTTATAGATCCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCC::::::::T:CGAGGATCCGGATTAGTCCAATTTGTTAAAGACAGGATATCAGTGGTCCAGGCTCTAGTTTTGACTCAACAATATCACCAGCTGAAGCCTATAGAGTACGAGCCATAGATAAAATAAAAGATTTTATTTAGTCTCCAGAAAAAGGGGGGAATGAAAGACCCCACCTGTAGGTTTGGCAAGCTAGCTTAAGTAACGCCATTTTGCAAGGCATGGAAAATACATAACTGAGAATAGAGAAGTTCAGATCAAGGTTAGGAACAGAGAGACAGCAGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGTTGGAACAGCAGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGTCCCCAGATGCGGTCCCGCCCTCAGCAGTTTCTAGAGAACCATCAGATGTTTCCAGGGTGCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACCAATCAGTTCGCTTCTCGCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCAATAAAAGAGCCCACAACCCCTCACTCGGCGCGCCAGTCCTCCGATAGACTGCGTCGCCTGGGTACTCGTGTTCTCA:TAAACCCTCTTGCAGTTGCATCCGACTCGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGATTGACTACCCGTCAGCGGGGGTCTTTCAGTTTCTCCCACCTACACAGGTCTCACTAACATTCCTGATGTGCCGCAGGNACTCCGTCAGCCCGGTTTTTGTTTA

Vector Information:

Vector Name:pJP1520
Type:bacterial plasmid
Description:Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Properties:Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Comments:One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Map:pJP1520.pdf
Sequence:pJP1520.txt
Size (bp):7894
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
HIP's T1 Phage-resistant DH5alpha Y From Harvard Institute of Proteomics

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
mammalian puromycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
Ed Harlow Academic researcher, clone PI
Joseph Pearlberg Academic researcher, clone donor and author