Clone: EvNO00017254 ← Click Here To Order

Clone ID:EvNO00017254
Is Verified:Y
Status:AVAILABLE
Source:Steve Elledge
Description:Lentiviral expression vector for shRNA expression with inducible (Tet) promoter, fluorescent (GFP) marker; amp resistance; MAGIC bacterial mating cloning.
Comments:This is an 'empty vector' version pPRIME for MAGIC bacterial mating-based strategy (see PMID 15731760)
Type:No insert
Verification Method:Sequence Verification
Distribution:Academic and non-profit labs
Special MTA:
Map:p126.JPG

Related Identifiers:

SYNONYM p126
SYNONYM pPRIME-TET-GFP-recipient
SYNONYM pPRIME-TET-GFP-PheS-recipient

Sequencing Information:

Phred Score: 845
Date: 2016-09-22

Last Passing Sequencing Read:

>25984-24_EvNO00017254-null_H3 845 1437 33 887 NNNNGGGCGGACTCCGCTGGAGAGCTNACAGTAGCGGCCGCAAGCCTTGT TAAGTGCTCGCTTCGGCAGCACATATACTATGTTGAATGAGGCTTCAGTA CTTTACAGAATCGTTGCCTGCACATCTTGGAAACACTTGCTGGGATTACT TCTTCAGGTTAACCCAACAGAAGGCCATGGGTCTAGATAGGGATAACAGG GTAATGGTACCGGATCCCCCAACTTCCAGGCCCGCCATAGTGATTTGATT TGCCAGCGCATCGCTATCAATCGCCGGGTTCACCCATTCGCGTAACCACA GTTCACTGAATTTCATAATCTATTCCTGCCTTATTTAAACTGTTTGAGGA AACGCAGATCGTTTTCGAAGAATGAACGCAGGTCGGTGACGCCGTAACGC AACATAGTCAGACGCTCCATCCCCATCCCGAAGCCGAAACCAGAGTAAAC TTCCGGGTCGATGCCAACGTTACGCAACACGTTCGGATGCACCATCCCGC AGCCCAGCACTTCCAGCCATTTACCGTTTTTACCCATGACGTCCACTTCT GCAGAAGGTTCGGTAAACGGGAAGTAGGAAGGACGGAAGCGAATCTGCAA ATCTTCCTCAAAGAAGTTACGCAGGAAGTCGTGCAGCGTGCCTTTCAGGT TGGTAAAGCTGATGTTGGTATCAACAATCAGACCTTCCATCTGATGGAAC ATCGGCGTGTGAGTCTGGTCGTAGTCGTTACGATAAACACGGCCAGGCGC GATGATACGAATCGGTGGCTGCTGGGCTTTCATGGTGCGGATCTGTACGC CAGAGGTCTGGGTACGCAGCANGCGGGTAGTGTCAAACCAGAAAGTGTCG TGGTCAGCGCGCGCCGGGTGGTGACCCAGAATGTCAGAGCATCGAAAGTA TGATAATCGTCTTCGATTTCCGGCCCCGNTNNGCACGGTAAGCCAAGCTC ACCGAAGAACTTTCGATACNGTCGATGGTACGGGTAACCGGATGCAGACC GCCGTTTTCATGCGACGACTGNCAGAGAGACATCATCGTTTTCGCCGCAG ACGCGCATCAGTGCACGCTTTCAGTTCCGCTTACCGCATTCACGCTGCTG AACTGCTTTCCGCTCGTGATACCGACCACTGCCGAAGCTCTCTGCGCAGC TCAGCAGTCGCATCGAAGGTAGTGCTTTTTACAATATTCAGCGAATACTA ACGGAACTTGACCTGGTAAGCCCTTCCTGAACATTGCAAAGGAAGGTTCT ATGGCAGGGACAGTTTGGATACCACCCAGGATTATCCTTTGCCAAACACC GAACTGTTCCAATGGGGGCTGCCGCCAAAAGTTCAAAAGGGTTTTATAGG GCGCAACCCCAAAAGGGCCCCAAAAAAACAAAAAAAAGAAATTTTNNNAA

Vector Information:

Vector Name:pPRIME-TET-GFP-recipient
Type:bacterial plasmid
Description:Lentiviral expression vector for shRNA expression with inducible (Tet) promoter, fluorescent (GFP) marker; amp resistance; MAGIC bacterial mating cloning.
Properties:MAGIC mating system, RNA interference, fluorescent marker, inducible expression, lentiviral infection, mammalian expression, mammalian transduction, retroviral vector, with tag/fusion/marker
Comments:MAGIC mating recipient for PRIME approach (Elledge Lab)
Map:p126.JPG
Sequence:p126.txt
Size (bp):8350
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
BW28705I/pML300 N Mating recipient host strain in LB/Sp50/Cb100/0.2% glycose at 30 degrees C (not 37 degrees C)
EB5-alpha T1, T5 phage resistant Y EB5-alpha host as supplied by Edge BioSystems

Antibiotic Selections:

Host Type Marker
bacterial ampicillin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
Steve Elledge Clone PI
Frank Stegmeier Clone first author and donor

Publications:

PMID Title
16141338 A lentiviral microRNA-based system for single-copy polymerase II-regulated RNA interference in mammalian cells
15731760 MAGIC, an in vivo genetic method for the rapid construction of recombinant DNA molecules