Clone: EvNO00013284 ← Click Here To Order

Clone ID:EvNO00013284
Is Verified:U
Status:AVAILABLE
Source:David Livingston
Description:Self-excising mammalian retroviral vector with Cre-GFP enzyme-marker and LoxP sites; ampicillin resistance
Comments:
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

SYNONYM pHit-n-Run
SYNONYM HR-MMPCreGFP
SYNONYM pMMPHit and Run CreGFP
SYNONYM pHR-MMP-CreGFP
SYNONYM pHR-MMP-Cre-GFP
SYNONYM pMMP-Hit-and-run-CreGFP
SYNONYM pHR-MMPCreGFP

Sequencing Information:

Phred Score: 879
Date: 2017-01-13

Last Passing Sequencing Read:

>26558-43_EvNO00013284-M13R_C6 879 1479 28 883 NNAAGATAGGCGAGCGTCGGCGTGAGGATCTCTAGGCAAGATGCCCTGAG ATCAGAGCCCCGGAACCGCGGGGACTCTGAGTATGCACTCTAGATTCCGA TCTGTCTGTACACAGGGGCAGGACCCCTTTTTATGGCAAAATCTCACACT GAGCCCAGGCAACCTTTTCACAGAAGCCTGCCCTCAGAGTATTAACTACT CTGCAATCGCCGTGCTCTCAGGAAGGGAGTGCAAACTAGAAATTTAAAAT ACGGAGAAGCCAGCAAAATAGACGAGGATAGATTGACTAAATCCCTCATC CAGGAGGCATAAAAATCTTAAAAGTCGTGTGGCAGATAGTCCACAGAGCC CTTCAACATTCTTTTATAAAGCCGAGAGTCAGGATGTAGTCTGGCTTGAA GGGAACACTGTTCTTGCATTTTATTATAAACAAAAACCGGGCTGACGGAG TCCCTGCGGCACATCAGGAATGTTAGTGAGACCTGTGTAGGTGGGAGAAA CTGAAAGACCCCCGCTGACGGGTAGTCAATCACTCAGAGGAGACCCTCCC AAGGAACAGCGAGACCACGAGTCGGATGCAACTGCAAGAGGGTTTATTGA GAACACGGGTACCCGGGCGACGCAGTCTATCGGAGGACTGGCGCGCCGAG TGAGGGGTTGTGGGCTCTTTTATTGAGCTCGGGGAGCAGAAGCGCGCGAA CAGAAGCGAGAAGCGAACTGATTGGTTAGTTCAAATAAGGCACAGGGTCA TTTCAGGTCCTTGGGGCACCCTGGAAACATCTGATGGTTCTCTAGAAACT GCTGAGGGCGGGACCGCATCTGGNGACCATCTGTTCTTGGCCCTGAGCCG GGGCAGGAACTGCTTACCACAGATATCCTGTTTGGCCCATATTCTGCTGT TCCAACTGTTCTTGGCCCTGAAGCGGGGCAGGAACTGCTTACCACAGATA TCCTGTTTGGCCCATATTCTGCTGTCTCTCTGTTCCTAACCTTGATCTGA ACTTCTCTATTCTCAGTATGTAGTTTCCATGCCTTGCAAAAGCCGGTACT AAGCTAGCAGGCCTATTACTTCCTATAATGGAACTATACAAGTTTTCATA CTTGCCAACCTCAGGTGGGTCTTTCATTCCCCCTTTTCTGAAACAATAAA ACTTTTATTTACATGCTCGTACCTATAGCTCCACTGGGGATTGGTGACCA AATAAAGCTGAACCCGAATCCGTCTTAAAATTGGACTACCGGAACACTTT GCTCCATGGCCCTTGTAAAGCTCCTGCTCGGGAACCCACACGTTAAACCA GAGGACGGGCCCCTTCTTGGATTTTAAGGAAATGTTAGAAGGTCTGGAAG AAGGCCCCCTGAATTGTTAAGCGCGAAGAACCCCCGGGCAATAAATAATC TTTTTGCGGTATTGGATATCCGGTGGGTGTCTTTTCTTTNNNNNNNNNNC

Vector Information:

Vector Name:pHR-MMPCreGFP
Type:bacterial plasmid
Description:Self-excising mammalian retroviral vector with Cre-GFP enzyme-marker and LoxP sites; ampicillin resistance
Properties:fluorescent marker, loxP, mammalian expression, mammalian transduction, retroviral vector, with tag/fusion/marker
Comments:Vector donor notes fussy to grow; try RecA+ strain and/or growth for 1 hour without selection to give it a boost.
Map:pHR-MMPCreGFP.pdf
Sequence:pHR-MMPCreGFP.txt
Size (bp):8142
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
EB5-alpha T1, T5 phage resistant Y EB5-alpha host as supplied by Edge BioSystems

Antibiotic Selections:

Host Type Marker
bacterial ampicillin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
Daniel Silver Clone donor
Daniel Silver Clone first author
David Livingston Clone PI

Publications:

PMID Title
11511376 Self-excising retroviral vectors encoding the Cre recombinase overcome Cre-mediated cellular toxicity