Clone: EvNO00013281 ← Click Here To Order

Clone ID:EvNO00013281
Is Verified:Y
Status:AVAILABLE
Source:Kurt Thorn
Description:Yeast fluorescent (tdimer2) vector with PTEF promoter; amp resistance (CaURA3 for yeast); restriction enzyme cloning.
Comments:
Type:No insert
Verification Method:Sequence Verification
Distribution:Academic and non-profit labs
Special MTA:TSIEN

Related Identifiers:

SYNONYM pKT0176
SYNONYM pFA6a-link-tdimer2-CaUra3
SYNONYM pKT176

Sequencing Information:

Phred Score: 853
Date: 2013-10-18

Last Passing Sequencing Read:

CGGGCGCATNGCCCTGNGGATCTGATATCATCGATGAATTCGAGCTCGTTTTCGACACTGGGATGGCGGCGTTAGTATCG AATCGACAGCAGTATAGCGACCAGCATTCACATACGATTGACGCATGATATTACTTTCTGCGCACTTAACTTCGCATCTG GGCAGATGATGTCGAGGCGAAAAAAAATATAAATCACGCTAACATTTGATTAAAATAGAACAACTACAATATAAAAAAAC TATACAAATGACAAGTTCTTGAAAACAAGAATCTTTTTATTGTCAGTACTGATTATAATTGGCCAGTCTTTTTCAAATAA GCATTCCAACCAGCATCTCTATACCTTTTACCTTCAATATCTGGATCTCTTCCTTTACCAAACAATCCTCTACCAACAAT GATAATATCAGTTCCAGTGCTAACAACTTCATCAACAGTTCTATATTGTTGTCCTAATCCATCACCTTTATCATCTAATC CAACTCCAGGTGTCATAATAAGCCAATCAAATCCTTCTTCTTGTCCACCCATATCACGTTGGGCAATAAATCCAATAACA AATTCCTTATCGGATTTAGCAATTTCAACAGTTTTTTGAGAATATTCTCCATATGCTAATGATCCCACTGATGATAATTC AGCTAACATCAATAACCCTCTTGGCTCTTGGTTGGTGGTGGTTTCTTTAGCTCCCTGTTTTAATCCTTCAACTACTCCAT TCCCAGTGACACCATGAGCATTAGTAATATCTGCCCAACTACTAATTTTATAAACTCCACCAATATATTGTTTCTTCACG GTATTACCAATATCAGCAAATTTTCTATCTTCAAAAATCATAAATTGATGTTTACGTGAAAGTTCTAATAATGGTTCANT AGTGGATCNTAGGAAAATCATGGATTATATCATATGAGTCTGGATTAAGCATACNTAAGGACCCATTTATCANTAATTCA GGGANTCCTTAGNGGNATCANCNTCAATGGANGCCNTAAATTGGNTTTCTCCAGTNCCTTAACGAAAAANCGTGGGCACN GGGGGGCANGANTTCGGCCCCCCCNAAGGNCTANGGTGACGCNNGGTGTTANGTCGNAGGAGGGAACNNTCCNNCNGATT NANGAGNTTGAAAAACNCGGGAATCTACTTTATTCNCNGGGGGGGGGGGAATCACNNCTGGNGGGGNTNCCGCCCNGCCC NNAGNCCANTTTTTCCCCNGGGCCCNANGGGGGGNNANATNNGGGGGGGGGNAAGGGGGAANCNTTCCCNNGNCCNAAAN NNGGGNTTGNCCNNNNGGGGGCCNGGNANNAAAANTNNNNNNCNNGGGGGGGGGGNNCCCNNNNNNNNNNGNNNNAANTT NNNNNNNNTTTTTTNNAAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCNCCGCCNN

Vector Information:

Vector Name:pKT176
Type:bacterial plasmid
Description:Yeast fluorescent (tdimer2) vector with PTEF promoter; amp resistance (CaURA3 for yeast); restriction enzyme cloning.
Properties:fluorescent marker, multiple cloning site, with tag/fusion/marker, yeast expression, yeast shuttle
Comments:
Map:pFA6a-link-tdimer2-CaUra3.pdf
Sequence:pFA6a-link-tdimer2-Ura3_FASTA.txt
Size (bp):5578
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
yeast URA

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
Kurt Thorn Clone PI
Kurt Thorn Clone donor

Publications:

PMID Title
15197731 Optimized cassettes for fluorescent protein tagging in Saccharomyces cerevisiae