Clone: HsCD00001264

Clone ID:HsCD00001264
Is Verified:Y
Status:AVAILABLE
Source:HIP
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:

Related Identifiers:

HIP Clone ID 118259
Original Clone ID FLH118259.01X
GI 61358254
GenBank Accession AY888594
HIP Master Clone ID 94105

Property:

Collection: Breast Cancer 1000

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 1344 Homo sapiens CLOSED 1st strand cDNA from placenta and brain 10062 NR1H3 nuclear receptor subfamily 1, group H, member 3
Insert1
Size (bp)1344
SpeciesHomo sapiens
FormatCLOSED
Tissue Source1st strand cDNA from placenta and brain
Species Specific ID 10062
Gene SymbolNR1H3
Gene Namenuclear receptor subfamily 1, group H, member 3
Keyword

Insert Sequence:

ATGTCCTTGTGGCTGGGGGCCCCTGTGCCTGACATTCCTCCTGACTCTGCGGTGGAGCTGTGGAAGCCAGGCGCACAGGATGCAAGCAGCCAGGCCCAGGGAGGCAGCAGCTGCATCCTCAGAGAGGAAGCCAGGATGCCCCACTCTGCTGGGGGTACTGCAGGGGTGGGGCTGGAGGCTGCAGAGCCCACAGCCCTGCTCACCAGGGCAGAGCCCCCTTCAGAACCCACAGAGATCCGTCCACAAAAGCGGAAAAAGGGGCCAGCCCCCAAAATGCTGGGGAACGAGCTATGCAGCGTGTGTGGGGACAAGGCCTCGGGCTTCCACTACAATGTTCTGAGCTGCGAGGGCTGCAAGGGATTCTTCCGCCGCAGCGTCATCAAGGGAGCGCACTACATCTGCCACAGTGGCGGCCACTGCCCCATGGACACCTACATGCGTCGCAAGTGCCAGGAGTGTCGGCTTCGCAAATGCCGTCAGGCTGGCATGCGGGAGGAGTGTGTCCTGTCAGAAGAACAGATCCGCCTGAAGAAACTGAAGCGGCAAGAGGAGGAACAGGCTCATGCCACATCCTTGCCCCCCAGGGCTTCCTCACCCCCCCAAATCCTGCCCCAGCTCAGCCCGGAACAACTGGGCATGATCGAGAAGCTCGTCGCTGCCCAGCAACAGTGTAACCGGCGCTCCTTTTCTGACCGGCTTCGAGTCACGCCTTGGCCCATGGCACCAGATCCCCATAGCCGGGAGGCCCGTCAGCAGCGCTTTGCCCACTTCACTGAGCTGGCCATCGTCTCTGTGCAGGAGATAGTTGACTTTGCTAAACAGCTACCCGGCTTCCTGCAGCTCAGCCGGGAGGACCAGATTGCCCTGCTGAAGACCTCTGCGATCGAGGTGATGCTTCTGGAGACATCTCGGAGGTACAACCCTGGGAGTGAGAGTATCACCTTCCTCAAGGATTTCAGTTATAACCGGGAAGACTTTGCCAAAGCAGGGCTGCAAGTGGAATTCATCAACCCCATCTTCGAGTTCTCCAGGGCCATGAATGAGCTGCAACTCAATGATGCCGAGTTTGCCTTGCTCATTGCTATCAGCATCTTCTCTGCAGACCGGCCCAACGTGCAGGACCAGCTCCAGGTAGAGAGGCTGCAGCACACATATGTGGAAGCCCTGCATGCCTACGTCTCCATCCACCATCCCCATGACCGACTGATGTTCCCACGGATGCTAATGAAACTGGTGAGCCTCCGGACCCTGAGCAGCGTCCACTCAGAGCAAGTGTTTGCACTGCGTCTGCAGGACAAAAAGCTCCCACCGCTGCTCTCTGAGATCTGGGATGTGCACGAATAG

Insert Property: Insert 1

Type Value Extra Information
Discrepancy c586g,g587c,R196A; g1134a
End on reference sequence 1379
Start on reference sequence 36

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTACGCGTGTAAAACGACGGCCAGTAGATCTGTAATACGACTCACTATAGGGCGCTAGCTGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTCGACACCATGTCCTTGTGGCTGGGGGCCCCTGTGCCTGACATTCCTCCTGACTCTGCGGTGGAGCTGTGGAAGCCAGGCGCACAGGATGCAAGCAGCCAGGCCCAGGGAGGCAGCAGCTGCATCCTCAGAGAGGAAGCCAGGATGCCCCACTCTGCTGGGGGTACTGCAGGGGTGGGGCTGGAGGCTGCAGAGCCCACAGCCCTGCTCACCAGGGCAGAGCCCCCTTCAGAACCCACAGAGATCCGTCCACAAAAGCGGAAAAAGGGGCCAGCCCCCAAAATGCTGGGGAACGAGCTATGCAGCGTGTGTGGGGACAAGGCCTCGGGCTTCCACTACAATGTTCTGAGCTGCGAGGGCTGCAAGGGATTCTTCCGCCGCAGCGTCATCAAGGGAGCGCACTACATCTGCCACAGTGGCGGCCACTGCCCCATGGACACCTACATGCGTCGCAAGTGCCAGGAGTGTCGGCTTCGCAAATGCCGTCAGGCTGGCATGCGGGAGGAGTGTGTCCTGTCAGAAGAACAGATCCGCCTGAAGAAACTGAAGCGGCAAGAGGAGGAACAGGCTCATGCCACATCCTTGCCCCCCAGGGCTTCCTCACCCCCCCAAATCCTGCCCCAGCTCAGCCCGGAACAACTGGGCATGATCGAGAAGCTCGTCGCTGCCCAGCAACAGTGTAACCGGCGCTCCTTTTCTGACCGGCTTCGAGTCACGCCTTGGCCCATGGCACCAGATCCCCATAGCCGGGAGGCCCGTCAGCAGCGCTTTGCCCACTTCACTGAGCTGGCCATCGTCTCTGTGCAGGAGATAGTTGACTTTGCTAAACAGCTACCCGGCTTCCTGCAGCTCAGCCGGGAGGACCAGATTGCCCTGCTGAAGACCTCTGCGATCGAGGTGATGCTTCTGGAGACATCTCGGAGGTACAACCCTGGGAGTGAGAGTATCACCTTCCTCAAGGATTTCAGTTATAACCGGGAAGACTTTGCCAAAGCAGGGCTGCAAGTGGAATTCATCAACCCCATCTTCGAGTTCTCCAGGGCCATGAATGAGCTGCAACTCAATGATGCCGAGTTTGCCTTGCTCATTGCTATCAGCATCTTCTCTGCAGACCGGCCCAACGTGCAGGACCAGCTCCAGGTAGAGAGGCTGCAGCACACATATGTGGAAGCCCTGCATGCCTACGTCTCCATCCACCATCCCCATGACCGACTGATGTTCCCACGGATGCTAATGAAACTGGTGAGCCTCCGGACCCTGAGCAGCGTCCACTCAGAGCAAGTGTTTGCACTGCGTCTGCAGGACAAAAAGCTCCCACCGCTGCTCTCTGAGATCTGGGATGTGCACGAATAGGGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCCAGGTAAGTGGTCATAATCATAATCATAATCATAATCATAATCACAACTAGCCTAGGAGATCCTGGTCATGACTAGTGCTTGGATTCTCACCAATAAAAAACGCCCGGCGGCAACCGAGCGTTCTGAACAAATCCAGATGGAGTTCTGAGGTCATTACTGGATCTATCAACAGGAGTCCAAGCGAGCTCGATATCAAATTACGCCCCGCCCTGCCACTCATCGCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCACAAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAGATCCATAACTTCGTATAGCATACATTATACGAAGTTATGCGGCCGCGACGTCCACATATACCTGCCGTTCACTATTATTTAGTGAAATGAGATATTATGATATTTTCTGAATTGTGATTAAAAAGGCAACTTTATGCCCATGCAACAGAAACTATAAAAAATACAGAGAATGAAAAGAAACAGATAGATTTTTTAGTTCTTTAGGCCCGTAGTCTGCAAATCCTTTTATGATTTTCTATCAAACAAAAGAGGAAAATAGACCAGTTGCAATCCAAACGAGAGTCTAATAGAATGAGGTCGAAAAGTAAATCGCGCGGGTTTGTTACTGATAAAGCAGGCAAGACCTAAAATGTGTAAAGGGCAAAGTGTATACTTTGGCGTCACCCCTTACATATTTTAGGTCTTTTTTTATTGTGCGTAACTAACTTGCCATCTTCAAACAGGAGGGCTGGAAGAAGCAGACCGCTAACACAGTACATAAAAAAGGAGACATGAACGATGAACATCAAAAAGTTTGCAAAACAAGCAACAGTATTAACCTTTACTACCGCACTGCTGGCAGGAGGCGCAACTCAAGCGTTTGCGAAAGAAACGAACCAAAAGCCATATAAGGAAACATACGGCATTTCCCATATTACACGCCATGATATGCTGCAAATCCCTGAACAGCAAAAAAATGAAAAATATCAAGTTCCTGAGTTCGATTCGTCCACAATTAAAAATATCTCTTCTGCAAAAGGCCTGGACGTTTGGGACAGCTGGCCATTACAAAACGCTGACGGCACTGTCGCAAACTATCACGGCTACCACATCGTCTTTGCATTAGCCGGAGATCCTAAAAATGCGGATGACACATCGATTTACATGTTCTATCAAAAAGTCGGCGAAACTTCTATTGACAGCTGGAAAAACGCTGGCCGCGTCTTTAAAGACAGCGACAAATTCGATGCAAATGATTCTATCCTAAAAGACCAAACACAAGAATGGTCAGGTTCAGCCACATTTACATCTGACGGAAAAATCCGTTTATTCTACACTGATTTCTCCGGTAAACATTACGGCAAACAAACACTGACAACTGCACAAGTTAACGTATCAGCATCAGACAGCTCTTTGAACATCAACGGTGTAGAGGATTATAAATCAATCTTTGACGGTGACGGAAAAACGTATCAAAATGTACAGCAGTTCATCGATGAAGGCAACTACAGCTCAGGCGACAACCATACGCTGAGAGATCCTCACTACGTAGAAGATAAAGGCCACAAATACTTAGTATTTGAAGCAAACACTGGAACTGAAGATGGCTACCAAGGCGAAGAATCTTTATTTAACAAAGCATACTATGGCAAAAGCACATCATTCTTCCGTCAAGAAAGTCAAAAACTTCTGCAAAGCGATAAAAAACGCACGGCTGAGTTAGCAAACGGCGCTCTCGGTATGATTGAGCTAAACGATGATTACACACTGAAAAAAGTGATGAAACCGCTGATTGCATCTAACACAGTAACAGATGAAATTGAACGCGCGAACGTCTTTAAAATGAACGGCAAATGGTACCTGTTCACTGACTCCCGCGGATCAAAAATGACGATTGACGGCATTACGTCTAACGATATTTACATGCTTGGTTATGTTTCTAATTCTTTAACTGGCCCATACAAGCCGCTGAACAAAACTGGCCTTGTGTTAAAAATGGATCTTGATCCTAACGATGTAACCTTTACTTACTCACACTTCGCTGTACCTCAAGCGAAAGGAAACAATGTCGTGATTACAAGCTATATGACAAACAGAGGATTCTACGCAGACAAACAATCAACGTTTGCGCCTAGCTTCCTGCTGAACATCAAAGGCAAGAAAACATCTGTTGTCAAAGACAGCATCCTTGAACAAGGACAATTAACAGTTAACAAATAAAAACGCAAAAGAAAATGCCGATATCCTATTGGCATTGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTC

Sequencing Information:

Phred Score: 859
Date: 2016-05-18

Last Passing Sequencing Read:

NNNCGTTTAANNNNNNGGATACTATGGGCTGCTCCCGCGCCGACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTCGACACCATGTCCTTGTGGCTGGGGGCCCCTGTGCCTGACATTCCTCCTGACTCTGCGGTGGAGCTGTGGAAGCCAGGCGCACAGGATGCAAGCAGCCAGGCCCAGGGAGGCAGCAGCTGCATCCTCAGAGAGGAAGCCAGGATGCCCCACTCTGCTGGGGGTACTGCAGGGGTGGGGCTGGAGGCTGCAGAGCCCACAGCCCTGCTCACCAGGGCAGAGCCCCCTTCAGAACCCACAGAGATCCGTCCACAAAAGCGGAAAAAGGGGCCAGCCCCCAAAATGCTGGGGAACGAGCTATGCAGCGTGTGTGGGGACAAGGCCTCGGGCTTCCACTACAATGTTCTGAGCTGCGAGGGCTGCAAGGGATTCTTCCGCCGCAGCGTCATCAAGGGAGCGCACTACATCTGCCACAGTGGCGGCCACTGCCCCATGGACACCTACATGCGTCGCAAGTGCCAGGAGTGTCGGCTTCGCAAATGCCGTCAGGCTGGCATGCGGGAGGAGTGTGTCCTGTCAGAAGAACAGATCCGCCTGAAGAAACTGAAGCGGCAAGAGGAGGAACAGGCTCATGCCACATCCTTGCCCCCCAGGGCTTCCTCACCCCCCCAAATCCTGCCCCAGCTCAGCCCGGAACAACTGGGCATGATCGAGAAGCTCGTCGCTGCCCAGCAACAGTGTAACCGGCGCTCCTTTTCTGACCGGCTTCGAGTCACGCCTTGGCCCATGGCACCAGATCCCCATAGCCGGGAGGCCCGTCAGCAGCGCTTTGCCCACTTCACTGAGCTGGCCATCGTCTCTGTGCAGGAGATAGTTGACTTTGCTAAACAGCTACCCGGCTTCCTGCAGCTCACCNGGNNAGACCAGATGCCCTGCTGAAGACTCTGCGATCGAAGTGATGCTTCTGGAGACTCTCGGAAGTACACCCTGGGAGTGAAAGTATCACCTTCTCAANNGATTCAGTATACCGGGAAGACTTTGCAAGCAGGCTGCAGTGAATTCATCACCCCATCTCGAGTTCTCAGGGCATGATGACTGCACTCATGATGCGAGTTGCTTGTCATGTTATACATCTCCTGCAAACGGCCACGTGAGACACTCCAGTAAAGCTCACCCCATATGAAGCTGGATGCTATTCCTCCCATCCCGACAATGTTCCCCGAGTTATAATGGGACCCCGACTGACAGCCCCAAAGGTTTCTGTTCGAAAAATCCCTTTCTAATGGGGGCAGGAATTTTACCTTGGGCCCAGGGGAAAAATATTTACCCCAAACTGTGTGGTTTTAACACCCCGCCCCCAAAGTTGTTTGTAAAAAACCCCCCCCTTTTTT

Vector Information:

Vector Name:pDNR-Dual
Type:bacterial plasmid
Description:Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Properties:Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Comments:The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Map:pDNR-Dual.pdf
Sequence:pDNR-Dual_FASTA.txt
Size (bp):4938
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial ampicillin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
HIP Academic Institute

Publications:

PMID Title
16512675 Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.