Clone: HsCD00001132

Clone ID:HsCD00001132
Is Verified:Y
Status:AVAILABLE
Source:HIP
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

HIP Clone ID 130936
Original Clone ID FLH130936.01L
GI 60827100
GenBank Accession AY893747
HIP Master Clone ID 107093

Property:

Collection: Transcription Factor

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 843 Homo sapiens FUSION 1st strand cDNA from placenta and brain 3280 HES1 hairy and enhancer of split 1, (Drosophila)
Insert1
Size (bp)843
SpeciesHomo sapiens
FormatFUSION
Tissue Source1st strand cDNA from placenta and brain
Species Specific ID 3280
Gene SymbolHES1
Gene Namehairy and enhancer of split 1, (Drosophila)
Keyword

Insert Sequence:

ATGCCAGCTGATATAATGGAGAAAAATTCCTCGTCCCCGGTGGCTGCTACCCCAGCCAGTGTCAACACGACACCGGATAAACCAAAGACAGCATCTGAGCACAGAAAGTCATCAAAGCCTATTATGGAGAAAAGACGAAGAGCAAGAATAAATGAAAGTCTGAGCCAGCTGAAAACACTGATTTTGGATGCTCTGAAGAAAGATAGCTCGCGGCATTCCAAGCTGGAGAAGGCGGACATTCTGGAAATGACAGTGAAGCACCTCCGGAACCTGCAGCGGGCGCAGATGACGGCTGCGCTGAGCACAGACCCAAGTGTGCTGGGGAAGTACCGAGCCGGCTTCAGCGAGTGCATGAACGAGGTGACCCGCTTCCTGTCCACGTGCGAGGGCGTTAATACCGAGGTGCGCACTCGGCTGCTCGGCCACCTGGCCAACTGCATGACCCAGATCAATGCCATGACCTACCCCGGGCAGCCGCACCCCGCCTTGCAGGCGCCGCCACCGCCCCCACCGGGACCCGGCGGCCCCCAGCACGCGCCGTTCGCGCCGCCGCCGCCACTCGTGCCCATCCCCGGGGGCGCGGCGCCCCCTCCCGGCGGCGCCCCCTGCAAGCTGGGCAGCCAGGCTGGAGAGGCGGCTAAGGTGTTTGGAGGCTTCCAGGTGGTACCGGCTCCCGATGGCCAGTTTGCTTTCCTCATTCCCAACGGGGCCTTCGCGCACAGCGGCCCTGTCATCCCCGTCTACACCAGCAACAGCGGCACCTCCGTGGGCCCCAACGCAGTGTCACCTTCCAGCGGCCCCTCGCTTACGGCGGACTCCATGTGGAGGCCGTGGCGGAACGAC

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 1079
Start on reference sequence 237

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

AGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCACCATGCCAGCTGATATAATGGAGAAAAATTCCTCGTCCCCGGTGGCTGCTACCCCAGCCAGTGTCAACACGACACCGGATAAACCAAAGACAGCATCTGAGCACAGAAAGTCATCAAAGCCTATTATGGAGAAAAGACGAAGAGCAAGAATAAATGAAAGTCTGAGCCAGCTGAAAACACTGATTTTGGATGCTCTGAAGAAAGATAGCTCGCGGCATTCCAAGCTGGAGAAGGCGGACATTCTGGAAATGACAGTGAAGCACCTCCGGAACCTGCAGCGGGCGCAGATGACGGCTGCGCTGAGCACAGACCCAAGTGTGCTGGGGAAGTACCGAGCCGGCTTCAGCGAGTGCATGAACGAGGTGACCCGCTTCCTGTCCACGTGCGAGGGCGTTAATACCGAGGTGCGCACTCGGCTGCTCGGCCACCTGGCCAACTGCATGACCCAGATCAATGCCATGACCTACCCCGGGCAGCCGCACCCCGCCTTGCAGGCGCCGCCACCGCCCCCACCGGGACCCGGCGGCCCCCAGCACGCGCCGTTCGCGCCGCCGCCGCCACTCGTGCCCATCCCCGGGGGCGCGGCGCCCCCTCCCGGCGGCGCCCCCTGCAAGCTGGGCAGCCAGGCTGGAGAGGCGGCTAAGGTGTTTGGAGGCTTCCAGGTGGTACCGGCTCCCGATGGCCAGTTTGCTTTCCTCATTCCCAACGGGGCCTTCGCGCACAGCGGCCCTGTCATCCCCGTCTACACCAGCAACAGCGGCACCTCCGTGGGCCCCAACGCAGTGTCACCTTCCAGCGGCCCCTCGCTTACGGCGGACTCCATGTGGAGGCCGTGGCGGAACGACGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGCTTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGAAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGAATTGGTTAATTGGTTGTAACACTGGCAGAGCATTACGCTGACTTGACGGGACGGCGCAAGCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAA

Sequencing Information:

Phred Score: 756
Date: 2017-03-01

Last Passing Sequencing Read:

NNNNCCGGCATAGATTTATTTTGATGATGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTCTTTGCCAACTTTGTACAAAAAAGCAGGCTCCACCATGCCACCTGATATAATGGAGAAAAATTCCTCGTCCCCGGTGGCTGCTACCCCAGCCAGTGTCAACACGACACCGGATAAACCAAAGACAGCATCTGAGCACAGAAAGTCATCAAAGCCTATTATGGAGAAAAGACGAAGAGCAAGAATAAATGAAAGTCTGAGCCAGCTGAAAACACTGATTTTGGATGCTCTGAAGAAAGATAGCTCGCGGCATTCCAAGCTGGAGAAGGCGGACATTCTGGAAATGACAGTGAAGCACCTCCGGAACCTGCAGCGGGCGCAGATGACGGCTGCGCTGAGCACAGACCCAAGTGTGCTGGGGAAGTACCGAGCCGGCTTCAGCGAGTGCATGAACGAGGTGACCCGCTTCCTGTCCACGTGCGAGGGCGTTAATACCGAGGTGCGCACTCGGCTGCTCGGCCACCTGGCCAACTGCATGACCCAGATCAATGCCATGACCTACCCCGGGCAGCCGCACCCCGCCTTGCAGGCGCCGCCACCGCCCCCACCGGGACCCGGCGGCCCCCAGCACGCGCCGTTCGCGCCGCCGCCGCCACTCGTGCCCATCCCCGGGGGCGCGGCGCCCCCTCCCGGCGGCGCCCCCTGCAAGCTGGGCAGCCAGGCTGGAGAGGCGGCTAACGTGTTTGGAGGCTTCCAGGTGGTACCGGCTCCCGATGGCCAGTTTGCTTTCCTCATTCTCAACGGGGCCTTCGCGCACAGCGGCCCTGTCATCCCCGTCTACACCAGCAACAGCGGCACCTCCGTGGGCTCCAACGCAGTGTCACCTTCCAGCGGCCCCTCGCTTACGGCGGACTCCATGTGGAGGCCGTGGCGGAACGACCCAGCTTTCTGTACAAAGTTGGCATTATCAGAAAGCATTGCTTATTCATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAATTCTTTATTGCCCTTCAGCTGCACCTCTGGCCCGTGTCTCAAATCCCCGATGGTACATTGCACAAGAATAAATTTATCATCCTGAACAATAAAACTGTCTGCCTACATAAACAGTAATACAAGGGGGTTTTGAACCATATCAACCGGGAAAGTCGAGCCCGCAATTAATTCCACCGGGATGCCGATTTTATTGGGTAAAAGGGCCTCCGAAATTTCGGGAATCGGGGCGACAATCTTCCTTGGATGGAACCCCATGCCCCAATGTTTTCTAAATGGCAAGGAGCGTTCCAGGATTTCAAAAAAGGCCAACAATTGGGGAAGAATTGCCCTCCACACAACCTTTTCCCCACCGGAAAAGGGTCTCCCG

Vector Information:

Vector Name:pDONR201
Type:bacterial plasmid
Description:Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Properties:Gateway, donor (entry), recombinational cloning
Comments:The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Map:pdonr201_pdonr207_map.pdf
Sequence:pDONR201_FASTA.txt
Size (bp):4470
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 50ug/mL kanamycin Growth with the single antibiotic in LB at 37 degrees is recommended. Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.

Authors:

Author Name Author Type
HIP Academic Institute